METHODOLOGICAL INSTRUCTIONS TO LESSON №6

June 7, 2024
0
0
Зміст

Main principles and methods of pure cultures isolation. Isolation of pure cultures of bacteria from the caries tooth cavity. Cultural properties of microorganisms.  Bacteria enzymes and their significances for identification. Identification of the isolated pure cultures of aerobic bacteria. Isolation and identification of pure cultures of anaerobic microorganisms

 

 

 

For selection the pure culture of microorganisms microorganism , it follows to separate numerous countless bacteria backterium which what are in tested material fabric , one from other. It is possible to attain by by means of methods which what are based on two principles – mechanical mechanics,power-operated and biological life-form separation separation of bacteria backterium .

 

Mechanical mechanics,power-operated principle

Biological life-form principle

METHODS

1. Factional fraction dilutions ( breeding,swinging,delution L. Pasteur’s technique)

2. Pour plate technique

 (Dilution in solid nutrient media breeding,swinging,delution by R. Koch’s technique)

3. Spread plate technique

(Superficial dispersions by Drigalsky’s technique)

4. Streak plate technique

 

METHODS

Take into account into consideration :

– Respiration pneusis type typestyle (Fortner’s method);

– bacterial motility vagility (Shukevich’s method

– resistance to acids (acid fast bacteria);

– sporulation ;

– temperature optimum;

– selective electoral   sensitiveness of laboratory laboratory-scale animals zoon to by the bacteria and so on backterium .

 

 

 

Methods based on mechanical mechanics,power–operated principle

Method of factional fraction dilutions ( breeding,swinging,delution L. Pasteur’s technique) is based on mechanical mechanics,power-operated disconnection separation of microorganisms by serial dilution in liquid nutrient media microorganism . The main lack of this technique: we caot make control the amount quantity of microbal is tested tubes.

Описание: Описание: Описание: Pasteur_technique

 

Pour plate technique  (Dilution in solid nutrient media breeding,swinging,delution by R. Koch’s technique) is based on dilution of microbes and pouring the tested material with gelatin. After cooling the gelatin isolated colonies of microorganisms microorganism are formed and they what easily can be transferred transfer on a fresh esh nutrient medium by by means of a platinum platinic loop noose,BH,loop-catheter for obtaining a microbial pure culture.

Описание: Описание: Описание: Pour_plate

 

Spread plate technique (Superficial dispersions by Drigalsky’s technique) is appear more perfect method which what is widely widespread wide-spread in everyday microbiological practice. There is quantitative technique that allows the determination of the number of bacteria in a sample.

Stages:

·                     Pipette the required amount of bacteria (from your dilution) on the surface of the Petri plate.

·                     Spread the inoculum over the surface of the agar medium using a hockey stick (spatula).

·                     Repeat this action on 3-4 Petri plates without sterilization of the hockey stick.

·                     Incubate the plate inverted at 37 oC.

There must be different number of microbial colony on the Petri plates.

Описание: Описание: Описание: spread_plate01

 

Описание: Описание: Описание: spred_plate11

Описание: Описание: Описание: image037

 

 

Описание: Описание: Описание: image221

 

Streak plate technique.

ADVANTAGES:

·       Spread millions of cells over the surface;

·       Individual cells deposited at a distance from all others;

·       Divide forming distinct colonies;

·       Distinct colonies do not touch any other colonies;

·       Clone of a single bacteria à pure culture

 

You streak the plate on 3 different portion of the Petri plate, so you can draw the section that you will streak on the bottom of your plate.

Stages:

·        Using a sterile loop take a loopful of your bacteria from the broth

·        Streak a vertical line

·        Then streak gently across section 1

·        Zig-zag pattern until a 1/3 of the plate is covered

·        Do not dig into the agar

·        Sterilize the loop à let it cool

·        Rotate the plate about 90 degrees and spread the bacteria from the first streak into a second area

·        Do only one streak (or very few) in the first area and once you are in the second area do not go back to the first

·        Do a zig-zag pattern until the 2nd area is covered

·        Sterilize again à do the same for 3rd area

·        Make sure that your red hot loop is cool enough prior to touch the bacteria

·        After you waited a few seconds

·        Stab it into the agar in a position away from bacteria à will cool it

·        If you stab where bacteria are à production of aerosol

·        Incubate the plate inverted at 37 oC.

In a day it is necessary to examine the colonies for future investigation.

 

Описание: Описание: Описание: Streak_marker

Описание: Описание: Описание: streak_palte01Описание: Описание: Описание: streak_palate02

 

Or:

Описание: Описание: Описание: streak_plate

Thus on this grow , substantial advantage of Pour plate technique (dilution in solid nutrient media breeding,swinging,delution by R. Koch’s technique), spread plate technique (superficial dispersions by Drigalsky’s technique), and streak plate technique consists in that they create the ability to obtain isolated (distinct) colonies of microorganisms microorganism which what can be transferred Wednesday on slant agar for pure culture obtaining.

 

Methods based on biological life-form principle

Biological life-form principle of disconnection separation of bacteria backterium foresees the purposeful search detect of methods which what take into account the numerous countless features feature of microbal species mew . Among the most widespread wide-spread methods it is possible to select the followings downstream :

1. Respiration pneusis type typestyle pneusis . All of microorganisms microorganism according to the type typestyle of respiration are divided into two basic main groups: aerobic aerobian (Corynebacterium diphtheriae , Vibrio сholerae and others) and anaerobic (Clostridium tetani , Clostridium botulinum , Clostridium perfringens and so on). If tested material fabric from which what it follows to select anaerobic bacteria to warm up preliminary, and then and then cultivate rearing in anaerobic terms, these bacteria backterium will grow exactly preeminently .

2. Sporulation. It is known that some certain microbes microbe,germ,microgerin (bacilli and clostridia ) form endospores. There are Clostridium tetani , Clostridium botulinum , Clostridium perfringens , Bacillus subtilis , Bacillus cereus among them . Spores are resistant against different external outward environment factors Wednesday . That’s why, if tested material would be heated previously and then inoculated iutrient medium spore-forming bacteria would be grown.

3. Resistance of microbes microbe,germ,microgerin against acids protophobe and alkali pratum . Some certain microbes microbe,germ,microgerin (Mycobacterium tuberculosis , Mycobacterium bovis ) as a result of because of,owing to their chemical structure features feature are resistant agains acids protophobe . That’s why tested material fabric with this bacteria previously is treated with 10 % sulfuric acid and later inoculated on proper nutrient medium what An extraneous strange flora perishes, and but mycobacteria as a result of because of,owing to their resistance to by acids protophobe grow.

Vibrio сholerae is appear a halophylic bacterium backterium , and for its growth it is inoculated in 1 % alkaline peptone water. Already in from,because of 4-6 hrs it growth like a tender bluish  pellicle on the surface of medium.

4. Bacteria motility backterium . Some certain microbes microbe,germ,microgerin (Proteus vulgaris ) have a tendency to by creeping growth height,step-up and is able fastness to spread quickly on the surface supface of moist humid,colliquative nutrient medium because they have flagella Wednesday . So such bacteria are inoculated in the drop of condensation liquid which what appears after the cooling the slant agar. In 16-18 hrs they spread on all surface supface of nutrient medium Wednesday . If material from the upper part of agar would be taken we will have a pure culture of microbe.

5. A susceptibility of microbes microbe,germ,microgerin to by different chemicals chinagraph , antibiotics etc.  As a result of because of,owing to features feature of metabolism some bacteria backterium have a different diverse susceptibility to by some certain chemical chinagraph factors. For example, staphylococci, aerobic aerobian bacilli can grow iutrient media which have 7,5–10 % to the sodium chloride natrum . That is why for the selection of these bacteria this substance is added into yalk-salt afar and mannitol-salt agar for their selection. Other bacteria backterium under the influence of such concentration of sodium chloride natrum do not grow practically.

Some certain antibiotics (nistatin ) is used for inhibition for pathogenic fungi growth if it is necessary to obtain only bacteria. Adding adds the Penicillin iutrient medium inhibit the growth only gram-positive bacteria. Presence of Furazolidon  makes favorite condition for Corynebacteria and Micriococci.

6. Ability power of microorganisms microorganism to penetrate through from,because of unharmed skin. Some certain pathogenic nosopoietic bacteria backterium (Yersinia pestis ) as a result of because of,owing to presence a lot of aggression enzymes are able to penetrate through from,because of an intact skin. For this purpose for this reason body wool of laboratory laboratory-scale animal zoon is shaven and tested material with different bacteria a rubbed in this skin area. Later some microbes may be obtain from the blood or internal organs microbe,germ,microgerin .

7. A sensitiveness of laboratory laboratory-scale animals zoon is to by the exciters of infectious diseases pathema . Some laboratory animals zoon show display a high susceptibility to by the different diverse microorganisms microorganism .

For example eg , after any method heliochrome of Streptococcus pneumoniae introduction input into a mouse generalized pneumococcal infection are developed. An analogical similar picture painting,oilpainting is observed exist after injection of Mycobacterium tuberculosis into Guinean pig or Mycobacterium bovis into the rabbit.

•         8. Temperature optimum. The cardinal temperatures:

– Minimum

–    Optimum

–    Maximum

Microorganisms can be grouped by the temperature ranges they require

•         Psychrophiles, low temperature optima (4°C) – Polaromonas vacuolata

•         Mesophils midrange (39°C) – Escherichia coli

•         Thermophiles high (60°C) –  Bacillus stearothermophilus

•         Hyperthermophiles  very high (>80°C) – Thermococcus celer

tisis

In everyday practice bacteriologists backteriolysis use such concepts notion as a species, a strain stamm,stamm-producer and pure culture of microorganisms microorganism .

Species – a collection of bacterial cells which share an overall similar pattern of traits in contrast to other bacteria whose pattern differs significantly

A strain is a subset of a bacterial species differing from other bacteria of the same species by some minor but identifiable difference. A strain is “a population of organisms that descends from a single organism or pure culture isolate. Strains within a species may differ slightly from one another in many ways.”

Culture: population of microorganisms grown under well defined conditions.

Pure culture – one that contains one type of microorganism.

 

Main Principles of the Cultivation of Microorganisms

Bacterial cultivation. In laboratory conditions microorganisms can be grown iutrient media in incubation chambers maintained at a constant temperature. According to the type of heating, incubation chambers can be subdivided into electric, gas and kerosene. Each incubation chamber has a thermoregulator which maintains a constant temperature. Temperature conditions are of great importance for the growth and reproduction of bacteria. In relation to conditions of temperature all micro-organisms can be subdivided into three groups: psychrophilic (Gk. psychros cold, philein love), mesophilic (Gk. mesos intermediate), thermophilic (Gk. thermos warm). Microorganisms may reproduce within a wide temperature regimen range of –10 to +80 °C.

Of great importance in the life activities of bacteria is the concentration of hydrogen ions in the nutrient medium, i. e. pH, which is expressed by the negative logarithm of the concentration of hydrogeons. The pH characterizes the degree of acidity or alkalinity, from extremely acid (pH 0) to extremely alkaline (pH 14) conditions.

During evolution each microbial species adapted itself to existence within certain limits of hydrogen ion concentration beyond the range of which its life processes are unable to take place; It has been suggested that pH influences the activity of enzymes. Depending on the pH, weak acids in an acid medium occur as molecules, and in an alkaline medium as ions. Saprophytes can live in conditions within a wide range of a pH from 0.6 to 11.0, while pathogenic species of microbes grow within certain limits of hydrogen ion concentration Nutrient media should be easily assimilable, and they should contain a known amount of nitrogen and carbohydrate substances, vitamins, a required salt concentration. In addition they should be isotonic, and sterile, and they should have buffer properties, an optimal viscosity, and a certain oxidation reduction potential.

During the whole history of microbiology nutrient media have gradually been perfected. Before Pasteur only infusions and decoctions were used as media for growing microbes. Pasteur and Nageli introduced non-protein media for the cultivation of microbes. Koch and Loeffler employed meat broth, peptone, and sodium chloride for growing microbes. This medium is a meat-peptone broth from which meat-peptone agar is prepared by adding 1-2 per cent industrial agar.

Agar (in Malayan – jelly) is compact fibrous material produced from some seaweed, forms in water solutions a solid gel. Agar contains 70-75% polysaccharides, 2-3% proteins and other nitrogen-containing substances, 2-4% ashes. Main components of agar high molecular weight substances — agarose and agaropectin. Agar dissolves in water while heating and solidifies at room temperature. It is manufactured as colourless plates or powder.

Because of the ability of agar upon cooling to give the nutrient medium a solid gel consistency, and due to its high resistance towards the microbial enzymes, it has received wide application in bacteriological techniques for preparing semisolid, solid, and dry nutrient media.

For the preparation of nutrient media M. Hottinger suggested the use of products of the tryptic breakdown of proteins which do not contain peptones, but contain the low molecular polypeptides and free amino acids. L. Martin employed papain as an enzyme for the break-down of proteins. In recent years all the essential amino acids and vitamins used for the cultivation of bacteria have been obtained in a pure state.

 

 

Isolation and Identification of Pure Culture of Aerobic Bacteria

 

Описание: Описание: Описание: image222

 

First day. Prepare smears of the tested material and study them under the microscope. Then, using a spatula or a bacteriological loop, streak the material onto a solid medium in a Petri dish. This ensures mechanical separation of microorganisms on the surface of the nutrient medium, which allows for their growth in isolated colo­nies. In individual cases the material to be studied is streaked onto the liquid enrichment medium and then transferred to Petri dishes with a solid nutrient medium. Place these dishes in a 37 0C incubator for 18-24 hrs.

Описание: Описание: Описание: посев_смеси

 

Описание: Описание: Описание: thermostate

Incubator

 

Second day. Following a 24-hour incubation, the cultural proper­ties of bacteria (nature of their growth on solid and liquid nutrient media) are studied.

Описание: Описание: Описание: coloОписание: Описание: Описание: ColoniesОписание: Описание: Описание: Colony1

 

Macroscopic examination of colonies in transmitted and reflect­ed light. Turn the dish with its bottom to the eyes and examine the colonies in transmitted light. In the presence of various types of col­onies count them and describe each of them. The following proper­ties are paid attention to; (a) size of colonies (largo, 4-5 mm in dia­meter or more; medium, 2-4 mm; small, 1-2 mm; minute, less than 1 mm); (b) configuration of colonies {regularly or irregularly round­ed, rosette-shaped, rhizoid, etc.); (c) degree of transparency (non-transparent, semitransparent, transparent).

In a reflected light, examine the colonies from the top without opening the lid. The following data are registered in the protocol: (a) colour of the colonies (colourless, pigmented, the colour of the pigment); (b) nature of the surface (smooth, glassy, moist, wrinkled, lustreless, dry, etc.); (c) position of the colonies on the nutrient medium (protruding above the medium, submerged into the medium; flat, at the level of the medium; flattened, slightly above the me­dium).

Microscopic examination of colonies. Mount the dish, bottom up­ward, on the stage of the microscope, lower the condenser, and, using an 8 x objective, study the colonies, registering in the protocol their structure (homogeneous or amorphous, granular, fibriliar, etc.) and the nature of their edges (smooth, wavy, jagged, fringy, etc.).

Use some portion of the colonies to prepare Gram-stained smears for microscopic examination. In the presence of uniform bacteria, transfer the remainder of colonies to an agar slant for obtaining a sufficient amount of pure culture. Place the test tubes with the in­oculated medium into a 37 °C incubator for 18-24 hrs.

Third day. Using the culture which has grown on the agar slant prepare smears and stain them by the Gram method. Such char­acteristics as homogeneity of the growth, form, size, and staining of microorganisms permit definite judgement as to purity of the cul­ture. To identify the isolated pure culture, supplement the study of morphological, tinctorial, and cultural features with determination of their enzymatic and antigenic attributes, phago- and bacterio-cinosensitivity, toxigenicity, and other properties characterizing their species specificity.

To demonstrate carbohydrate-splitting enzymes, Hiss’ media are utilized. When bacteria ferment carbohydrates with acid formation, the colour of the medium changes due to the indicator present in it. Depending on the kind and species of bacteria studied, select media with respective mono- and disaccharides (glucose, lactose, maltose, sucrose), polysaccharides (starch, glycogen, inulin), higher alcohols (glycerol, mannitol). In the process of fermentation of the above sub­stances aldehydes, acids, and gaseous products (CO2, H2, etc.) are formed.

To demonstrate proteolytic enzymes in bacteria, transfer the lat­ter to a gelatin column. Allow the inoculated culture to stand at room temperature (20-22 °C) for several days, recording not only the development of liquefaction per se but its character as well (lami­nar, in the form of a nail or a fir-tree, etc.)

Proteolytic action of enzymes of microorganisms can also be ob­served following their streaking onto coagulated serum, with depres­sions forming around colonies (liquefaction). A casein clot is split in milk to form peptone, which is manifested by the fact that milk turns yellowish (milk peptonization).

More profound splitting of protein is evidenced by the formation of indol, ammonia, hydrogen sulphide, and other compounds. To detect the gaseous substances, inoculate microorganisms into a meat-peptone broth or in a 1 per cent peptone water. Leave the inocula­ted cultures in an incubator for 24-72 hrs.

To demonstrate indol by Morel’s method, soak narrow strips of filter paper with hot saturated solution of oxalic acid (indicator pa­per) and let them dry. Place the indicator paper between the test tube wall and stopper so that it does not touch the streaked medium. When indol is released by the 2nd-3rd day, the lower part of the pa­per strip turns pink as a result of its interaction with oxalic acid.

The telltale sign of the presence of ammonia is a change in the col­our of a pink litmus paper fastened between the tube wall and the stopper (it turns blue). Hydrogen sulphide is detected by means of a filter paper strip saturated with lead acetate solution, which is fast­ened between the tube wall and the stopper. Upon interaction be­tween hydrogen sulphide and lead acetate the paper darkens as a re­sult of lead sulphide formation.

To determine catalase, pour 1-2 ml of a 1 per cent hydrogen per­oxide solution over the surface of a 24-hour culture of an agar slant. The appearance of gas bubbles is considered as a positive reaction. Use a culture known to contain catalase as a control.

The reduction ability of microorganisms is studied using methylene blue, thinning, litmus, indigo carmine, neutral red, etc. Add one of the above dyes to nutrient broth or agar. The medium decolorizes if the microorganism has a reduction ability. The most widely em­ployed is Rothberger’s medium (meat-peptone agar containing 1 per cent of glucose and several drops of a saturated solution of neutral red). If the reaction is positive, a red colour of the agar changes into yellow, yellow-green, and fluorescent, while glucose fermentation is characterized by cracks in the medium.

Antigen properties of the isolated culture are investigated by the agglutination test (see p. 37) and other serological tests.

Species identification of aerobic bacteria is performed by compar­ing their morphological, cultural, biochemical, antigenic, and other properties.

 

On solid nutrient media microbes form colonies of different shapes and sizes which are  ggregations of individuals connected by bands of  cytoplasm providing for a certain structure of bacterial groupings. The colonies may be flat. convex, dome-shaped, or pitted; their surface – smooth (S-forms). rough (R-forms). ridged, or bumpy; their edges may be straight, serralcd. fibrous, or lasseled. The shape of the colonies also differs: e.g. round, rosette-shaped, star-shaped, tree-like. According lo their size the colonies may be divided into large (4-5 mm in diameter), intermediate (2-4 mm), small (1-2 mm), and dwarf (less than 1 mm).

The colonies differ in their consistency, density, and colour. They may be transparent and opaque, coloured and colourless, moist, dry, and slimy.

In liquid nutrient media microbes grow producing a duffuse suspen- sion. film. or precipitate visible to the naked eye.

The growth of bacteria in the laboratory is carried out in test tubes, Petri dishes, and flasks.

In institutes for production of vaccines the cultivation of aerobes is carried out by deep stab methods. This method permits a more rational use of the nutrient substrate, and a large microbial mass can be obtained. The cultures are grown in reactors. Aeration is produced by passing a stream of air through the medium. The method of aeration is used in laboratory investigations to promote rapid growth of bacteria and to study some processes of metabolism.

Reproduction in microbes takes place more intensively in a flowing nutrient medium which is constantly being renewed. For this purpose a spare tank with nutrient medium is installed, from which  the mediumenters the cultivator and is carefully mixed with the culture.

  

 

Colonies of a different structure.

 

After this the excess of cultural fluid together with the suspended bacterial cells flows out. When the rate of flow of cells from the cultivator is equal to the rate of reproduction, the number of the microbial population remains constant.

Modem plant equipment is supplied with devices for automatic control over reproduction and other microbiological processes.

In usual laboratory conditions anaerobes develop in stationary or portable anaerostats containing rarefied air up to 1-8 mm or in vacuum desiccators.

 

         

 

        Stationary anaerostat (jar)

 

 

Описание: Описание: Описание: R_36_anaerostat

Portable anaerostat

 

For successfully cultivating anaerobes it is necessary to seed a large amount of material into the nutrient medium. The nutrient medium should have a certain viscosity which is attained by adding 0.2 per cent agar. The air is removed by boiling prior to seeding, and to inhibit thesubsequent entry of air, the medium is covered with a layer of oil 0.5-1 cm thick. Anaerobiosis is obtained by the adsorption of oxygen on porous substances (pumice, cotton wool, coal) and by adding reducing substances (carbohydrates, peptone, cysteine. pieces of liver, spleen, kidneys, brain, etc.). After seeding, the test tubes are filled up with liquid vaseline. Growth of the anaerobes is usually carried out on a Kitt-Tarozzi

 

Isolation and identification of a pure culture

First day

1. Microscopic examination of the tested material.

2. Streaking of the material tested onto nutrient media (solid, liquid).

Second day

1. Investigation  of the   cultural properties.

2. Sub-inoculation of colonies onto solid media to enrich for a pure culture.

Third day

1. Checking of the purity of the iso­lated culture.

2. Investigation of biochemical prop­erties: (a) sugarlytic, (b) proteolytic.

3. Determination of antigenic prop­erties.

4. Study of phagosensitivity, phagotyping, colicinogensitivity, colicinogenotyping, sensitivity to an­tibiotics, and other properties.

 

With regards to obtaining microorganisms in pure culture, are based on mechanical divorced of bacteria tested material inoculate onto surface  media in Petri dish by bacteriological loop or pipette and after that streak plating evenly. After that again that glass spatula (don’t burn through the flame) was used for streak plating onto the same second media in Petri dish.The seeding has been done by bacteriological loop too. With that purpose in upper part of Petri dish has been made dense streaking, set free bacteriological loop from superfluous material. After that are made paralel streaks at the last part of the agar. Somever are applied method of laminar dilution, the matter of this method is a stiring diferrent serial dillution tested materials with melting and colling agar in tubes.After that its are flooded into Petri dishes and put down into incubator.The tested materials are boiled of short duration or heat on 80 0C for destroy bacteria without spores. The spores of microorganisms leave still alive and ater reinoculate this materials they are grown.

Fortner method. The agar media is divided  into two parts. Onto the one part inoculate E.coli or Serratia marcescens (these microorganisms absorb intensively oxygen) and onto second part  taested material. Closely  stop up this Petri dish  by parafin and put down into the thermostat. This method is used for obtainig anerobe culture.

 

 

 

Isolation and Identification of Pure Culture of Anaerobic Bacteria

 

Methods of obtaining making anaerobic conditions. Taking into account that free molecular oxygen Oxygenium,oxegen is appear toxic toxiferous,toxical for obligate anaerobic bacteria backterium , the main condition of such microorganisms cultivation culturing microorganism is appear limitation of its its access. There are some methods (mechanical mechanics,power-operated , physical physics , biological life-form ) which what allow providing secure it.

Toxic forms of oxygen

•  Certain oxygen derivatives are toxic to microorganisms.

•  Oxygen in its ground state is triplet oxygen (3O2).

•  Toxic forms of oxygen include singlet oxygen 1O2,

(superoxide anion) O2-, hydrogen peroxide H2O2 and hydroxyl radical (OH-).

As molecules have an unpaired electron, they are very reactive and cause destruction.

 

Enzymes that destroy toxic oxygen

·                                             Enzymes are present in cells that can neutralise most toxic forms of oxygen.

·                                             Catalase

·                                             Peroxidase

·                                             Superoxide dismutase

 

Physical physics methods. 1. Before inoculation of bacteria backterium on/iutrient media it is necessarily of course to regenerate them for deletion erasion of surplus overabundance oxygen ( Oxygenium,oxegen boiling them for for 15-20 min in water bath, quickl fastness cooling cooling to by the necessary temperature).

2. For warning oxygen Oxygenium,oxegen penetration into nutrient medium it must be covered with the layer of sterile vaseline oil oil or paraffin (for liquid media).

3. A column of nutrient media in test tubes must be quite high (10-12 cm q.v. ). Oxygen Oxygenium,oxegen , as a rule, penetrates into the column of medium on a depth up to 2 cm q.v. , that is why that is why favourable propitious,auspicious conditions for cultivation culturing of anaerobic microbes create below microbe,germ,microgerin .

Описание: Описание: Описание: Column_agar_anaer

 

4. An evacuation and replaceable method foresees the use utillizing of anaerobic jar . They are hermetically sealed metallic metallical or plastic jars from which what it is possible to pump out oxygen Oxygenium,oxegen and replace changeover it by special gases (helium, nitrogen, argon). Triple gas mixture hodgepodge which what consists of nitrogen 80 %, carbon dioxide 10 %, and hydrogen 10 % is used Hydrogenium . Sometimes natural gas may be used. For a deoxygenation in the jar palladic catalysts are used catalist . For absorption of aquatic watery,hydro steams calcium chloride ca , silicagel and others substances are used in the jars.

Описание: Описание: Описание: jar1

 

5. Place the burning candle into the flask or jar with Petri plates.

Описание: Описание: Описание: свеча

Chemical chinagraph methods foresee the use utillizing of substances absorb an oxygen ( Oxygenium,oxegen alkaline solution of pyrogallol, sodium natrum hydrosulphite (Na2S2O4 ).

There may be used special reduced substances add : cysteine (0,03-0,0,5 %), thioglycolic acid protophobe or sodium natrum thioglycolate (0,01-0,02 %), sodium sulphide, ascorbic acid (0,1 %), different sugars .

Such functions have pieces bit of animals parenchymatous organs viscus (liver, kidneys kidney , heart coeur ) or even plants (potato).

The degree of deoxygenation or degree of nutrient medium reduction may be measured by by means of indicators (rezazurine , neutral midway red, phenosafranine).

3. Use utillizing of the special gas generating systems which what allow to create oxygen-free conditions in the jars , transport cargo-carrying plastic packages packet,paks and so on. One of most widespread wide-spread there is the system of “Gas Generating Box ”.

The GasPak™ EZ Gas Generating Pouch Systems are single-use systems that produce atmospheres suitable to support the primary isolation and cultivation of anaerobic, microaerophilic, or capnophilic bacteria by use of gas generating sachets inside single-use resealable pouches. The GasPak EZ Gas Generating Sachet consists of a reagent sachet containing inorganic carbonate, activated carbon, ascorbic (citric) acid and water. When the sachet is removed from the outer wrapper, the sachet becomes activated by exposure to air. The activated reagent sachet and specimens are placed in the GasPak EZ Incubation Container and the container is sealed. The sachet rapidly reduces the oxygen concentration within the container. At the same time, inorganic carbonate produces carbon dioxide.

Anaerobic environment-action: The gas generator envelope is activated by the addition of water; Hydrogen generated from a sodium borohydride tablet combines with the oxygen in the jar in the presence of the palladium catalyst to form water, removing the oxygen.

Anaerobic conditions are achieved rapidly, generally within 1 hour of incubation; the carbon dioxide concentration is approximately 4-10%. At 35 °C, the Gas Pak methylene blue anaerobic indicator becomes decolorized at 4-6 hours.

Описание: Описание: Описание: Gas_pack_system

 

Описание: Описание: Описание: jar

Gas Pak with  indicator strip and  CO2 generator pack

 

Biological life-form methods. 1. Fortner’s method. A method includes general common cultivation culturing outrient medium an aerobic aerobian and an anaerobic microorganisms microorganism . At first part of nutrient medium in Petri plate aerobic bacteria  (Serratia marcescens) are inoculated, at second – tested material with anaerobic bacteria. The edges place of cup are closed hermetically (e.g. with paraffin). In a few days the colonies both aerobic aerobian and anaerobic microbes microbe,germ,microgerin grow. Serratia marcescens forms pink pinkish or colourless colonies, and but when there are violations of hermetic conditions – bright red ones bright red,vermillion . The colonies of anaerobic microbes microbe,germ,microgerin grow on other half hf of Petri plate.

2. Hennel’s technique (“watch glasses technique ”). There is original modification of previous one preliminary . Tested material fabric with maintain anaerobic bacteria is inoculated on the square 2-2,5 cm in diameter. q.v. Later it is covered by special convex glass where is nutrient medium and Serratia marcescens on it . Aerobic aerobian microbes (Serratia spp.) microbe,germ,microgerin taking an oxygen Oxygenium,oxegen create favourable propitious,auspicious conditions for anaerobes growth height,step-up .

Now the stationary anaerobic boxes for cultivation of anaerobic bacteria are made.

Описание: Описание: Описание: anaer_box

 

One of the main requirements in cultivating anaerobic bacteria is removal of oxygen from the nutrient medium. The content of oxygen can be reduced by a great variety of methods: immersing of the sur­face of the nutrient medium with petrolatum, introduction of micro­organisms deep into a solid nutrient medium, the use of special anaerobic jars.

First day. Inoculate the studied material into Kitt-Tarozzi medi­um (nutrient medium): concentrated meat-peptone broth or Hottinger’s broth, glucose, 0.15 per cent agar (pHl 7.2-7.4).

To adsorb oxygen, place pieces of boiled liver or minced meat to form a 1-1.5 cm layer and pieces of cotton wool on the bottom of the test tube and pour in 6-7 mi of the medium. Prior to inoculation place the medium into boiling water for 10-20 min in order to remove air oxygen contained in it and then let it cool. Upon isolation of spore forms of anaerobes the inoculated culture is reheated at 80 ‘”C for 20-30 min to kill non-spore-forming bacteria. The cultures are immersed with petrolatum and placed into an incubator. Apart from Kitt-Tarozzi medium, liquid media containing 0.5-1 per cent glucose and pieces of animal organs, casein-acid and casein-mycotic hydrolysates can also be employed.

Casein-acid medium’, casein-acid hydrolysate, 0.5 1; 10 per cent yeast extract, 0.35 1: 20 per cent corn extract, 0.15 1; millet, 240 g; cotton wool, 25 g. The me­dium is poured into flasks with millet and cotton wool and sterilized for 30 min at 110 0C. Use casein-mycotic hydrolysate to obtain casein-mycotic me­dium.

Second day. Take note of changes in the enrichment medium, namely, the appearance of opacification or opacification in combination with gas formation. Take broth culture with a’ Pasteur pipette and transfer it through a layer of petrolatum onto the bottom of the test tube. Prepare smears on a glass slide in the usual manner, then flame fix and Gram-stain them.During microscopic examination record the presence of Gram-positive rod forms (with or without spores). Streak the culture from the enrichment medium onto solid nutrient media. Isolated colonies are prepared by two methods.

1. Prepare three plates with blood-sugar agar. To do it, melt and cool to 45 °C 100 ml of 2 per cent agnr on llottinger’s broth, then add 10-15 ml of deftbrinated sheep or rabbit blood and 10 ml of 20 per cent sterile glucose. Take a drop of the medium witli microorgan­isms into the first plate and spread it along the surface, using a glass spatula. Use the same spatula to streak tlic culture onto tlie second and then third plates and place them into an anaerobic jar or other similar devices at 37 ”C for 24-48 hrs (Zoisslcr’s method).

2, Anaerobic microorganisms are grown deep in a solid nutrient medium (Veinherg’s method of sequential dilutions). The culture from the medium is taken with a Pasteur pipette with a soldcd tip and transferred consecutively into the 1st, 2nd, and 3rd test tubes with 10 ml of isotonic sodium chloride solution. Continue to dilute^ transferring the material into the 4th, 5th. and 6th thin-walled test tubes (0.8 cm in diameter and 18 cm in height) with melted and cooled to 50 °C meat-peptone agar or Wilson-Blair medium (to 100 ml of melted meat-peptone agar with 1 per cent glucose add 10 ml of 20 per cent sodium sulphite solution and 1 ml of 8 per cent ferric chloride). Alter agar has solidified, place the inoculated culture into an incubator.

On the third day, study the isolated colonies formed in tlie plates and make smears from the most typical ones. The remainder is in­oculated into Kitt-Tarozzi medium. The colonies in the test tubes are removed by means of a sterile Pasteur pipette or the agar column may be pushed out of the tube by steam generated upon warming the bottom of the test tube. Some portion of the colony is used to prepare smears, while its remainder is inoculated into Kitt-Tarozzi medium to enrich pure culture to be later identified by its morpholo­gical, cultural, biochemical, toxicogenic, antigenic, and other properties.

The Vinyale-Veyone’s method is used for mechanical protection from oxygen. The seeding are made into tube with melting and cooling (at 42 0C) agar media.

 

 

Culture Media for the Growth of Bacteria

For any bacterium to be propagated for any purpose it is necessary to provide the appropriate biochemical and biophysical environment. The biochemical (nutritional) environment is made available as a culture medium, and depending upon the special needs of particular bacteria (as well as particular investigators) a large variety and types of culture media have been developed with different purposes and uses. Culture media are employed in the isolation and maintenance of pure cultures of bacteria and are also used for identification of bacteria according to their biochemical and physiological properties. Nutrient media should be easily assimilable, and they should contain a known amount of nitrogen and carbohydrate substances, vitamins, a required salt concentration. In addition they should be isotonic, and sterile, and they should have buffer properties, an optimal viscosity, and a certain oxidation-reduction potential.

Описание: Описание: Описание: Media_class

The manner in which bacteria are cultivated, and the purpose of culture media, vary widely. Liquid media are used for growth of pure batch cultures while solidified media are used widely for the isolation of pure cultures, for estimating viable bacterial populations, and a variety of other purposes. The usual gelling agent for solid or semisolid medium is agar, a hydrocolloid derived from red algae. Agar is used because of its unique physical properties (it melts at 100 degrees and remains liquid until cooled to 40 degrees, the temperature at which it gels) and because it cannot be metabolized by most bacteria. Hence as a medium component it is relatively inert; it simply holds (gels) nutrients that are in aquaeous solution.

Описание: Описание: Описание: R_17_streak

Culture media may be classified into several categories depending on their composition or use. A chemically-defined (synthetic) medium is one in which the exact chemical composition is known.

Defined media are usually composed of pure biochemicals off the shelf; complex media usually contain complex materials of biological origin such as blood or milk or yeast extract or beef extract, the exact chemical composition of which is obviously undetermined. A defined medium is a minimal medium if it provides only the exact nutrients (including any growth factors) needed by the organism for growth. The use of defined minimal media requires the investigator to know the exact nutritional requirements of the organisms in question. Chemically-defined media are of value in studying the minimal nutritional requirements of microorganisms, for enrichment cultures, and for a wide variety of physiological studies. Complex media usually provide the full range of growth factors that may be required by an organism so they may be more handily used to cultivate unknown bacteria or bacteria whose nutritional requirement are complex (i.e., organisms that require a lot of growth factors).

Most pathogenic bacteria of animals, which have adapted themselves to growth in animal tissues, require complex media for their growth. Blood, serum and tissue extracts are frequently added to culture media for the cultivation of pathogens. Even so, for a few fastidious pathogens such as Treponema pallidum, the agent of syphilis, and Mycobacterium leprae, the cause of leprosy, artificial culture media and conditions have not been established. This fact thwarts the the ability to do basic research on these pathogens and the diseases that they cause.

Other concepts employed in the construction of culture media are the principles of selection and enrichment. A selective medium is one which has a component(s) added to it which will inhibit or prevent the growth of certain types or species of bacteria and/or promote the growth of desired species. One can also adjust the physical conditions of a culture medium, such as pH and temperature, to render it selective for organisms that are able to grow under these certain conditions.

A culture medium may also be a differential medium if allows the investigator to distinguish between different types of bacteria based on some observable trait in their pattern of growth on the medium. Thus a selective, differential medium for the isolation of Staphylococcus aureus, the most common bacterial pathogen of humans, contains a very high concentration of salt (which the staph will tolerate) that inhibits most other bacteria, mannitol as a source of fermentable sugar, and a pH indicator dye. From clinical specimens, only staphylococcus will grow. S. aureus is differentiated from S. epidermidis (a nonpathogenic component of the normal flora) on the basis of its ability to ferment mannitol. Mannitol-fermenting colonies (S. aureus) produce acid which reacts with the indicator dye forming a colored halo around the colonies; mannitol non-fermenters (S. epidermidis) use other non-fermentative substrates in the medium for growth and do not form a halo around their colonies.

 

Описание: Описание: Описание: Different_media

 

Описание: Описание: Описание: R_25_E_coli_Endo

An enrichment medium employs a slightly different twist. An enrichment medium contains some component that permits the growth of specific types or species of bacteria, usually because they alone can utilize the component from their environment. However, an enrichment medium may have selective features. An enrichment medium for nonsymbiotic nitrogen-fixing bacteria omits a source of added nitrogen to the medium. The medium is inoculated with a potential source of these bacteria (e.g. a soil sample) and incubated in the atmosphere wherein the only source of nitrogen available is N2. A selective enrichment medium for growth of the extreme halophile (Halococcus) contains nearly 25 percent salt [NaCl], which is required by the extreme halophile and which inhibits the growth of all other procaryotes.

 

Thus, nutrient media can be subdivided into three main groups:

I. Ordinary (simple) media which include meat-peptone broth, meat-peptone agar, etc.

II. Special media (serum agar, serum broth, coagulated serum, pota­toes, blood agar, blood broth, etc.).

Quite often elective media are employed in laboratory practice in which only certain species of bacteria grow well, and other species either grow poorly or do not grow at all. Enriched media are also employed in which the species of interest to the scientist grows more intensively and more rapidly than the accompanying bacteria. Thus, for example, on Endo’s medium (elective) the growth of the Gram-positive microbes is inhibited while alkaline peptone water and alkaline meat-peptone agar serve as enriched media for the cholera vibrio. Nutrient media contain­ing certain concentrations of penicillin are elective for penicillin-resis­tant strains of bacteria, but unfavourable for penicillin-sensitive strains.

III. Differential diagnostic media: (1) media for the determination of the proteolytic action of microbes (meat-peptone gelatine); (2) media for the determination of the fermentation of carbohydrates (Hiss media); media for the differentiation of bacteria which do and do not fer­ment lactose (Ploskirev, Drigalsky, Endo. etc.); (3) media for the deter­mination of haemolytic activity (blood agar); (4) media for the deter­mination of the reductive activity of micro-organisms; (5) media containing substances assimilated only by certain microbes.

Besides, in laboratory practice conservation media are used. They are used for primary seeding and transportation of the material under test. They prevent the death of pathogenic microbes and enhance the inhibi­tion of saprophytes. This group of media includes a glycerin mixture composed of two parts 0.85 per cent salt solution, 1 part glycerin, and I part 15-20 per cent acid sodium phosphate, and also a glycerin preser­vative with lithium salts, a hypertonic salt solution, etc.

At present many nutrient media are prepared commercially as dry powders. They are convenient to work with, are stable, and quite effective.

Non-protein media are widely used for the cultivation of bacteria, on which many heterotrophic microbes including pathogenic species grow well. The composition of these media is complex and includes a large number of components.

When cultivating in synthetic media, the use of the method of radioactive tracers has permitted a more detailed differentiation of mic­robes according to the character of their biosynthesis.

Selective media are widely used for differentiating prototrophic and ULixotrophic bacteria. Prototrophs grow on a minimum medium which contains only salts and carbohydrates since they themselves are capable til’ synthesizing the metaholites necessary for their development. Auxo-Irophs. in distinction, require definite media containing amino acids, vitamins, and other substances.

In consistency nutrient media may be solid (meat-peptone agar, meat-peptone gelatine, coagulated serum, potato, coagulated white of Ihc egg), semisolid (0.5 per cent meat-peptone agar), and liquid (peptone water, meat-peptone broth, sugar broth, etc.).

 

Enzymes and Their Role in Metabolism

Enzymes, organic catalysts of a highly molecular structure, are produced by the living cell. They are of a proteiature, are strictly specific in action, and play an important part in the metabolism of microorganisms. Their specificity is associated with active centres formed by a group of amino acids.

Enzymes of microbial origin have various effects and are highly active. They have found a wide application in industry, agriculture and medicine, and are gradually replacing preparations produced by higher plants and animals.

With the help of amylase produced by mould fungi starch is saccharified and this is employed in beer making, industrial alcohol production and bread making. Proteinases produced by microbes are used for removing the hair from hides, tanning hides, liquefying the gelatinous layer from films during regeneration, and for dry cleaning. Fibrinolysin produced by streptococci dissolves the thrombi in human blood vessels. Enzymes which hydrolyse cellulose aid in an easier assimilation of rough fodder.

Due to the application of microbial enzymes, the medical industry has been able to obtain alkaloids, polysaccharides, and steroids (hydrocortisone, prednisone, prednisolone. etc.).

Bacteria play an important role in the treatment of caoutchouc, collon. silk. coffee, cocoa, and tobacco: significant processes lake place under their effect which change these substances essentially in the needed direction. In specific weight the synthetic capacity of microorganisms is very high. The total weight of bacterial cytoplasm on earth is much higher than that of animal cytoplasm. The biochemical activity of microbes is of no less general biological importance than that of photosynthesis. The cessation of the existence of microorganisms would lead inevitably to the death of plants and animals.

Enzymes permit some species of micro-organisms to assimilate methane. butane, and other hydrocarbons, and to synthesize complex organic compounds from them. Thus, for example, with the help of the enzymatic ability of yeasts in special-type industrial installations protein-vitamin concentrates (PVC) can be obtained from waste products of petroleum (paraffins), which are employed in animal husbandry as a valuable nutrient substance supplementing rough fodder. Some soil micro-organisms destroy by means of enzymes chemical substances (carcinogens) which are detrimental to the human body because they induce malignant tumours.

Some enzymes are excreted by the cell into the environment (exoenzymes) for breaking down complex colloid nutrient materials while other enzymes are contained inside the cell (endoenzymes).

Depending on the conditions of origin of enzymes there are constitutive enzymes which are constantly found in the cell irrespective of the presence of a catalysing substrate. These include the main enzymes of cellular metabolism (lipase. carbohydrase. proteinase, oxydase, etc.). Adaptive enzymes occur only in the presence of the corresponding substrate (penicillinase, amino acid decarboxylase, alkaline phosphatase, B-galactosidase, etc.). The synthesis of induced enzymes in microbes occurs due to the presence in the cells of free amino acids and with the participation of ready proteins found in the bacteria.

According to chemical properties enzymes can be subdivided into three groups:

1 – enzymes composed only of proteins:

2 – enzymes containing in addition, to protein metallic ions essential for their activity, and assisting m the combination of the enzyme with the substrate, and taking part in the cyclic enzymatic transformations:

3 – enzymes which contain distinct organic molecules (coenzymes. prosthetic groups) essential for their activity. Some enzymes contain vitamins.

Bacterial enzymes are subdivided into some groups:

1. Hydrolases which catalyse the breakdown of the link between the carbon and nitrogen atoms, between the oxygen and sulphur atoms, binding one molecule of water (esterases. glucosidases, proteases.  amidases, nucleases, etc.).

2. Transferases perform catalysis by transferring certain radicals from one molecule to another (transglucosidases, transacylases. transaminases).

3. Oxidative enzymes (oxyreductases) which catalyse the oxidation reduction processes (oxidases, dehydrogenases, peroxidases, catalases).

4. Isomerases and racemases play an important part in carbohydrate metabolism. They are found in most species of bacteria. Phosphohexoisomerase, galactovaldenase, phosphoglucomutase,  hosphoglyceromutase pertain to the isomerases.

The absorption of food material by the cell is a rather complex process. Unicellular protozoa are  characterized by a holozoic type of nutrition in which hard food particles are swallowed, digested and converted to soluble compounds. Bacteria, algae, fungi, and plants possess a holophytik  type of nutrition. They absorb nutrients in a dissolved state. This difference, however, is not essential because the cells of protozoa, just like the cells of plant organisms, utilize nutrient substrates which are soluble in water or in the cell sap, while many bacteria and fungi can assimilate hard nutrients first splitting them by external digestion by means of exoenzymes. During diffusion the dissolved substance is transferred from the region of higher concentration outside the cell into the bacterial cell until the concentration becomes the same. The passage of a solvent through the cytoplasmic membrane of bacteria from a region where it is less concentrated to one where it is more concentrated is performed by osmosis. The concentration gradient and osmotic power on both sides of the cytoplasmic membrane are quite different, and depend on the difference in concentration of many substances contained in the cell and nutrient medium. The transfer of dissolved substances from the nutrient medium to the cell can take place by suction together with the solvent if the membrane is sufficiently porous.

It has been established that the cellular membranes are made up of lipid and protein molecules arranged in a certain sequence. The charged groups of molecules have their ends directed towards the surface of the membrane. On these charged ends the protein layers are adsorbed, composed of protein chains forming a meshwork on the external and internal surfaces of the membrane. The high selectivity which allows the cells to distinguish certain substances from others depends on the presence of enzymatic systems localized on the surface of bacterial cells. Due to the action of these enzymes, the insoluble substances in the membrane become soluble.

The cell membranes play an important role in metabolism. They are capable of changing rapidly their permeability to various substances and regulating in this way the entry of substances into the cell and their distribution in it, and the development of reactions in which these substances participate.

Some bacteria (Salmonella typhimurium} possess rudiments of memory. They recognize whether the medium is favourable or unfavourable to them. They ‘run away’ from an unfavourable one by means of flagella: when close to a favourable medium (glucose) Salmonella organisms swim to the ‘bait’. This ability to recognize the needed direction is probably accomplished by the trial-and-error method.

In the process of bacterial nutrition great importance is attached to exchange adsorption. The active  transport of ions takes place due to (he difference in charges on the surface of membranes in the cell wall and the surrounding medium of the micro-organisms. Besides, the role of transporters, as has been suggested, is performed by liposoluble substances X and Y. Compounds are formed with ions of potassium and sodium (KX and NaY) which are capable of diffusing through the cell wall, while the membrane remains unpenetrable for free transporters. Proteins concerned with the transport of amino acids have been isolated from the membranes of some micro-organisms, and protein systems responsible for the transfer of certain sugars in general and glucose in particular have been revealed.

 

 

Bases of bacterial Identification

 

Identification is the determination of whether an organism (or isolate in the case of microorganisms ) should be placed within a group of organisms known to fit within some classification scheme.

 

Through the early part of the twentieth century, there appeared to be a general feeling that the same battery of observations and tests could be used to characterize and identify any kind of bacterium. But as different, “exotic” types of bacteria were discovered, it was found that they would tend not to grow in the standard test media nor even in the usual conditions of incubation. Obligate parasites and strict anaerobes were among the emerging groups of bacteria needing special methods for growth and characterization. By the 1930s, a standard descriptive chart was developed for uniformity in recording the characteristics of the “aerobic saprophytes” (which are equivalent to what we call the “commonly-found chemoheterotrophs” in our general courses today)..

As we now know, a huge battery of tests done at once to identify an unknown organism would result in a lot of media and time being wasted dealing with irrelevant tests. (Time and media are money!) Thus we would like to proceed in stages, running those tests which are applicable to what basic knowledge we have about our unknown. That is, a very different set of tests would be run on a gram-negative rod compared to a gram-positive coccus.

There is no medium (differential or otherwise) that can possibly support the growth of all of the different species of bacteria. As an example, many different formulations exist for media to detect glucose fermentation, based outrient requirements of various groups of bacteria. Also, when running the standard test for oxygen relationship with Thioglycollate Medium, consider that (1) many organisms (including a lot of chemoheterotrophs!) cannot grow in this medium and (2) the medium does not allow for anaerobic growth which is due to phototrophy (more specifically, metabolism in the presence of light as performed by the non-oxygen-evolving photosynthetic bacteria) or anaerobic respiration (the use of alternate electron acceptors such as nitrate and sulfate).

In Bergey’s Manual and other bacteriological texts, reference is made to the oxygen relationships of various bacteria – that is, how bacteria metabolize and replicate (if at all) in the presence or absence of oxygen.

Molecular oxygen (O2) is the electron acceptor utilized by organisms which obtain energy from respiration (i.e., aerobic respiration). However, it does not function as such for organisms which obtain energy from fermentation, photosynthesis or anaerobic respiration.

For the following discussion, it may be helpful to review basic catabolic processes such as what is covered on this page. Also, a review of respiration vs. fermentation is given here.

 

I. In the most elementary sense, living organisms can be classified according to “oxygen relationships” as follows: (1) strict (or obligate) aerobes – those which require O2, (2) strict (or obligate) anaerobes – those which can only grow in the absence of O2, and (3) facultative anaerobes – those which can grow in the presence or absence of O2. Practicing bacteriologists do not settle for this oversimplification as we see in the following two sections.

II. Bergey’s Manual applies oxygen relationship categories to the chemotrophic bacteria, and the definitions which follow are taken verbatim from those in Bergey’s Manual of Determinative Bacteriology (9th ed., 1994) except for the items in brackets:

 

[Strict or Obligate] Aerobe: An organism that is capable of using oxygen as a terminal electron acceptor [i.e., aerobic respiration], can tolerate a level of oxygen equivalent to or higher than that present in an air atmosphere (21% oxygen), and has a strictly respiratory type of metabolism. Some aerobes may also be capable of growing anaerobically with electron acceptors other than oxygen [i.e., anaerobic respiration].

 

Facultative anaerobe: An organism that can grow well both in the absence of oxygen and in the presence of a level of oxygen equivalent to that in an air atmosphere (21% oxygen). Some are capable of growing aerobically by respiring with oxygen and anaerobically by fermentation [anaerobic respiration is also possible]; others have a strictly fermentative type of metabolism and do not respire with oxygen. [We form the “aerotolerant anaerobe” category with the latter type; see below.]

 

Microaerophile: An organism that is capable of oxygen-dependent growth but cannot grow in the presence of a level of oxygen equivalent to that present in an air atmosphere (21% oxygen). Oxygen-dependant growth [i.e., aerobic respiration] occurs only at low oxygen levels. In addition to being able to respire with oxygen, some microaerophiles may be capable of respiring anaerobically with electron acceptors other than oxygen.

 

[Strict or Obligate] Anaerobe: An organism that is incapable of oxygen-dependent growth and cannot grow in the presence of an oxygen concentration equivalent to that present in an air atmosphere (21% oxygen). Some anaerobes may have a fermentative type of metabolism; others may carry out anaerobic respiration in which a terminal electron acceptor other than oxygen is used. [The primary consideration for defining an organism as a strict anaerobe is its total intolerance of oxygen.]

 

With these Bergey’s Manual definitions, phototrophs would be categorized with difficulty if at all. As one example, the purple non-sulfur photosynthetic bacteria can respire and can also grow anaerobically, but anaerobic growth is associated with the organisms’ use of energy derived from light, not (except for certain exceptional strains and species) from fermentation or anaerobic respiration.

 

III. Thioglycollate Medium – which we utilize in our Bacteriology laboratory courses – is a “standard” medium for the determination of oxygen relationships, and it will support the growth of common, easily-grown chemoheterotrophic bacteria. The observed growth patterns of organisms in this medium determine their oxygen relationship designations (strict aerobe, facultative anaerobe, etc.) which correlate with such physiological abilities as respiration, fermentation and the catalase reaction and also whether there is an inhibitory effect on the organism in the presence of air. See the table under the photo below. Thus, a description of a chemoheterotrophic organism as a “strict aerobe” can imply a number of associated characteristics that may be unnecessary to specify separately (able to respire, unable to ferment, catalase-positive, azide-sensitive, etc.).

The amino acids and glucose in the medium can be respired, and glucose is the only fermentable energy source in the medium except for those exceptional organisms such as certain species of Clostridium which can ferment amino acids.

With Thioglycollate Medium, we are able to differentiate two distinct patterns of growth for those classified in the Bergey’s Manual definitions (above) as “facultative anaerobes”:

Those which are indifferent to oxygen and have a strictly fermentative type of metabolism grow evenly throughout the medium. We term such an organism an aerotolerant anaerobe and set that off as an additional category of oxygen relationship (added to the list of four above).

Those left in the facultative anaerobe category show greater concentration of growth at the top of the medium where oxygen is present and aerobic respiration is then possible. Comparing the degree of growth under aerobic vs. anaerobic conditions can be a good demonstration of the relative efficiencies of aerobic respiration and fermentation when it comes to generation of cell mass.

The terms “facultative” and “aerotolerant” are always meant to modify another term such as “anaerobe” and they should not be used by themselves. Describing an organism as simply “facultative” may mean “facultative anaerobe,” “facultative phototroph,” or a variety of other things.

One must consider the following limitations of Thioglycollate Medium:

Many organisms (including a lot of chemoheterotrophs) cannot grow in this medium for one reason or another.

No allowance is given in the medium or method for anaerobic growth (1) with alternate electron acceptors (such as nitrate) or (2) in light (such as what is seen with the anoxygenic photosynthetic bacteria). Thus, an organism which may be termed a “strict anaerobe” in the more general sense – i.e., one which cannot tolerate oxygen and can only obtain energy by reactions which do not involve O2 – would only show anaerobic growth in this test if it were capable of fermentation of the glucose in this medium.

The results in Thioglycollate Medium can be difficult to read. As shown in the table below, an organism’s oxygen relationship designation can be determined by a combination of other methods which can be used as a check to see if the medium is showing the correct results – i.e., (1) testing for fermentation in Glucose Fermentation Broth, (2) performing the catalase test, and (3) testing if the organism can grow in the presence of oxygen. These methods tend to be quite reliable and can be utilized if Thioglycollate Medium is not available or even specified for use in the identification process. With that in mind, Thioglycollate Medium could be considered redundant.

The results we see in Thioglycollate Medium are shown below. (Note that microaerophiles are not included.) The accompanying table gives related information.

 

Описание: Описание: Описание: thiomed2

 

Corresponding tube no. above

1

2

3

4

Oxygen relationship designation

STRICT

(OBLIGATE)

AEROBE

FACULTATIVE

ANAEROBE 

AEROTOLERANT

ANAEROBE

STRICT

(OBLIGATE)

ANAEROBE

 

Aerobic respiration* 

+

+

–

–

Fermentation*

–

+

+

+

Ability to grow aerobically

(oxygen tolerance)

+

+

+

–

Ability to grow anaerobically

–

+

+

+

Catalase reaction

+

+

–

–

Reaction in Glucose O/F Medium

(for those able to grow well in medium)

O or –

F

 

 

Response to sodium azide in a growth medium

 

SENSITIVE

SENSITIVE (under aerobic conditions)

RESISTANT

RESISTANT

 

*  These are the basic things tested for in this medium. Whether or not any organism can obtain energy by anaerobic respiration or phototrophy is not relevant to these designations of oxygen relationships.

 

So, in becoming a practicing bacteriologist, one will see that there is more to this concept than whether bacteria simply “like” or “don’t like” oxygen – which, unfortunately, is the extent to which oxygen relationships are too-often and unconscionably taught.

 

IV. Rather than (or in addition to) using “oxygen relationships” as descriptive terms – however they may be determined or defined – we can characterize and classify bacteria more consistently and comprehensively by applying the method(s) of energy generation of which an organism is capable:

aerobic respiration

anaerobic respiration

fermentation

anoxygenic phototrophy

oxygenic phototrophy

 

Remember that Thioglycollate Medium tests for an organism’s ability to perform aerobic respiration and/or fermentation – the results of which give us the “oxygen relationship” categories for those organisms which can grow in the medium under the incubation conditions provided. Anaerobic growth in this medium is only associated with fermentation.

 

V. The following summary may help to explain how media formulations can allow anaerobic growth for organisms capable of doing so for one reason or another. The same organism – a typical strain of E. coli – was inoculated into tubes 1, 2 and 3, and a “facultative phototroph” was inoculated into tube 4.

 

In Tube #1, we have a medium containing peptone and agar plus other nutrients a “typical organism” (i.e., a commonly-found, easy-to-grow chemo- or photoheterotroph) might require for metabolism and replication – except that nothing is included which would support anaerobic growth such as glucose (or something else that could be fermented) or nitrate (or some other electron acceptor/”oxygen substitute” that could be used in anaerobic respiration). After inoculation of this medium and incubation in the dark, any growth would be due to aerobic respiration with the growth only at the top of the medium. There would be no anaerobic growth except for some rare, exceptional organisms which can ferment amino acids.

Описание: Описание: Описание: xmed

 

Tube #2 is the same medium as in #1, but glucose has been added. After incubation (in the dark), any anaerobic growth would be due to fermentation of the glucose. Thus the medium can be used to detect whether or not an organism can respire (aerobically) or ferment. An example of such a medium is the Thioglycollate Medium we use to test common chemoheterotrophs for “oxygen relationships” (discussed above).

 

Tube #3 is the same medium as in #1, but potassium nitrate has been added. After incubation (in the dark), any anaerobic growth would be due to anaerobic respiration where the organism is using nitrate as the electron acceptor. In Bact. 102 (Exp. 7), we do a test in a broth medium for nitrate reduction; with reagents we can detect nitrite formation, and with the Durham tube we can detect N2 gas formation. One can probably see why we would not want to include nitrate in the Thioglycollate Medium above.

 

Tube #4 is the same medium as in #1, but we have incubated the tube in the presence of light. With light as the ultimate energy source, anaerobic growth would be due to anoxygenic phototrophy. This is the basis for the test we do in Bact. 102 (Exp. 11.1) to see if our isolates of purple non-sulfur bacteria are either “strict phototrophs” (just anaerobic growth in the light) or “facultative phototrophs” (anaerobic growth in the light, plus aerobic growth due to aerobic respiration whether in the dark or the light). Click here for a summary of this test.

 

Glucose Fermentation Broth and O/F Medium

 

First, a quick review of respiration vs. fermentation: we deal mostly with chemotrophic bacteria – primarily the chemoheterotrophs. Depending on the abilities of any specific chemotrophic organism and the environment in which it is found, the catabolic pathway is involved with either oxidative or substrate-level phosphorylation. If the former, the organism is obtaining energy by respiration; if the latter, the process is fermentation. Relative comparisons are made between respiration and fermentation in the following outline. (The three kinds of “phosphorylation” are diagrammed under respiration, fermentation and phototrophy on the catabolism page.)

 

Respiration:

There is a greater variety of potential substrates (amino acids, sugars, etc.). The substrate is more completely broken down than by fermentation.

A relatively smaller variety of end products is produced. A small amount of acidic intermediates can accumulate when respiring organisms catabolize sugars (such as for Pseudomonas species which utilize the Entner-Douderoff pathway). ATP is generated by oxidative phosphorylation wherein relatively more ATP is generated than by substrate-level phosphorylation, and oxygen is utilized as the terminal electron acceptor. Certain respiring organisms can use an alternate terminal electron acceptor such as nitrate under anaerobic conditions; this situation is termed anaerobic respiration. Relatively more cell mass is generated.

 

Fermentation:

A smaller variety of substrates can be fermented. Many organisms which can ferment sugars will not ferment amino acids. The substrate is less completely broken down. A relatively larger variety of end products is produced. Much acid (and possibly gas) is produced when sugars are fermented. ATP is generated by substrate-level phosphorylation wherein relatively less ATP is generated than by oxidative phosphorylation. Oxygen is not involved in the process. Relatively less cell mass is generated.

 

Both Glucose Fermentation Broth  and Glucose O/F Medium include the following major ingredients:

Glucose – a sugar from which most common chemoheterotrophic bacteria can obtain energy – by fermentation and/or respiration. Glucose can also be utilized as a source of carbon, but these media include a large number of potential carbon sources (amino acids as well as glucose), and whether or not glucose is used as a carbon source cannot be directly determined from the reactions seen in these media.

Peptone – a commonly-used medium ingredient which mainly supplies amino acids (sources of nitrogen, carbon, sulfur and energy for many bacteria). It is a crude preparation of a partially-digested protein, and a peptone solution can serve as a complete medium for a number of organisms such as E. coli. If too much peptone (relative to glucose) is incorporated in the medium, detection of acidic products of fermentation or respiration may not be possible, as overabundance of ammonium (which is alkaline) released from the breakdown of amino acids caeutralize the acids.

pH indicator – the pH indicators employed in these media turn yellow under acidic conditions. Brom-cresol purple is in Glucose Fermentation Broth (which also contains the Durham tube), and brom-thymol blue is in Glucose O/F Medium.

 

Glucose Fermentation Broth

Testing whether an organism can ferment glucose is one of the basic, primary tests in the identification of chemoheterotrophic bacteria. For this test we routinely use a “Glucose Fermentation Broth.”

Fermentation of glucose results in the abundant production of acidic end products, the presence of which can be detected by the pH indicator in the medium.

Many organisms produce gas – either CO2 alone or a mixture of H2 and CO2. H2 is insoluble and is detected by bubble formation in a Durham tube placed in the medium.  

Note the examples shown below.

 

Tube 1: No fermentation. The pH indicator remains purple. There can still be growth due to the use of amino acids as sources of energy (usually by respiration).

Tubes 2A and 2B: Fermentation with the production of acid (yellow color) but no gas. A slight amount of acid is seen in tube 2A, but fermentation is still recorded for this tube.

Tubes 3A and 3B: Fermentation with the production of acid (yellow color) and insoluble gas (bubble in Durham tube). Tube 3B shows an alkaline reaction on top; this is simply due to deamination of amino acids whose alkaline reaction has not been over-neutralized by the acid diffusing through the tube from fermentation.

 

Описание: Описание: Описание: gfb2

 

Furthermore, with any of the reactions shown here, amino acids and/or glucose can be used as sources of carbon, but determination of what is or is not used as a carbon source cannot be made with this medium.

 

Glucose O/F Medium

The original intention of this medium was to be able to differentiate between gram-negative bacteria (1) that can ferment, (2) that only catabolize glucose by respiration and (3) that do not catabolize glucose at all. This differentiation is not as important in the identification of gram-positive bacteria, and it so happens that gram-positive bacteria do not grow in Glucose O/F Medium well (if at all) anyway – probably because of some sensitivity to the pH indicator. It is a waste of time and money to use this medium to characterize gram-positive cultures.

Whether an organism can respire or ferment glucose can be tested with Glucose O/F Medium. A small amount of acid production can be associated with glucose respiration. The original paper which describes the medium gives the example of the Entner-Douderoff pathway that is utilized by a variety of generally gram-negative bacteria (including Pseudomonas) to convert glucose to pyruvate – an alternative method of pyruvate formation to that of the Embden-Meyeroff pathway. (Pyruvate is further oxidized to CO2 in the aerobic respiration process.) Among the intermediates in the Entner-Douderoff pathway are forms of gluconic acid. So, where a strictly aerobic organism producing this acid is growing – i.e., at the top of the medium where O2 is available – a net acidic reaction will be seen. However, this acidic reaction would be rendered indistinguishable if the organism were a facultative anaerobe – in which case the large amount of acid (produced by fermentation in the anaerobic environment of the tube) would be diffusing throughout the entire medium.

Duplicate tubes are inoculated for each organism, and the medium in one of the tubes is overlayed with mineral oil. Mineral oil does not in itself cause anaerobic conditions but rather prevents oxygen from continuing to diffuse into the medium. After incubation, one looks for the presence and location of growth and acid.

It is important to emphasize that this medium contains relatively less peptone and more glucose than Glucose Fermentation Broth, so the acid associated with respiration can be detected in the aerobic part of the non-overlayed tube – if it is not made indistinguishable by acid production from fermentation which turns both tubes yellow throughout.

Note the examples shown below. For each pair of tubes, the tube on the right was overlayed with mineral oil after inoculation.

 

First pair of tubes: Tubes were inoculated with a strict aerobe which neither respires nor ferments glucose – therefore no acidic reaction. The blue alkaline reaction shows up where there is growth at the top of the “aerobic” tube. This is the negative reaction.

Second pair of tubes: Tubes were inoculated with a strict aerobe which respires but does not ferment glucose. The small amount of acid associated with respiration shows up where there is growth at the top of the “aerobic” tube. This is the “O” reaction, typical for most species of Pseudomonas. (The alkaline reaction from amino acid deamination is overneutralized.)

Third pair of tubes: Tubes were inoculated with a facultative anaerobe – i.e., one which can respire (with O2) and ferment. Acid from the fermentation of glucose diffuses throughout both the “aerobic” and “anaerobic” tubes. This is the “F” reaction, typical of the enterics. (The alkaline reaction from amino acid deamination is overneutralized. Also, one cannot discern any acid production that might be associated with respiration.)

 

Описание: Описание: Описание: newglucof2

 

Pair of Tubes

1st

2nd

3rd

Aerobic deamination of amino acids – not relevant to glucose catabolism

(This occurs in upper part of open tube)

+

(Blue alkaline reaction seen; not over-neutralized by any acid production.)

+

(Alkaline reaction overneutralized by acid.)

 

+

(Alkaline reaction overneutralized by acid.)

Respiration of glucose

(Acid seen in upper part of open tube)

–

+

This cannot be discerned due to the high amount of acid produced from fermentation.

Fermentation of glucose

(Acid diffuses throughout both tubes)

–

–

+

Reaction recorded 

Negative

O

F

 

 

Additional comparisons between these two media are here

 

The following examples show the behavior of four organisms in both Glucose Fermentation Broth and Glucose O/F Medium. The organisms are gram-negative except Staphylococcus epidermidis which grows weakly in Glucose O/F Medium.

 

“EC” = Escherichia coli

“PF” = Pseudomonas fluorescens

“AF” = Alcaligenes faecalis

“SE” = Staphylococcus epidermidis  “1” = Glucose O/F Medium

“2” = same with mineral oil overlay

“3” = Glucose Fermentation Broth

 

Описание: Описание: Описание: glucose2

 

Reaction types

Escherichia coli

Pseudomonas fluorescens

Alcaligenes faecalis

Staphylococcus epidermidis

Organism ferments glucose (and can grow anaerobically as a result)

+

(Also produces

H2 and CO2)

–

–

+

Acidic reaction from fermentation seen throughout both media

+

(Note gas

in Durham tube)

–

–

(Weak growth in Glucose

O/F Medium)

 

Organism respires glucose

+

+

–

+

Acidic reaction from respiration seen in open Glucose O/F Medium tube

Can’t tell due to acid from fermentation permeating medium

+

–

(Alkaline reaction from peptone becomes apparent)

Can’t tell due to acid from fermentation permeating medium

Reaction recorded for Glucose O/F Medium

F

O

–

(weak F)

 

 

For certain groups of bacteria, different formulations of Glucose Fermentation Broth are employed which satisfy special growth requirements. For example, clinical streptococci and dairy lactobacilli require a much richer basal medium than that provided by peptone. Likewise, a variation of Glucose O/F Medium is used for the characterization of Staphylococcus and Micrococcus. Bergey’s Manual and other reference books give more specific information.

 

As genotypic characterization (determination of the DNA and RNA characteristics of our bacteria) is becoming more widely practiced, we may soon be back to one standard of characterizing and identifying bacteria. This time it will be universally applicable as all bacterial genera and species become uniformly defined according to genotypic uniqueness. We hope that the results of the phenotypic tests we run will correlate with the genotypic characteristics and bring about accurate and useful identification of our organisms.

 

In the table below, a few commonly-found and easily-grown chemoheterotrophic genera are sorted out based on various “primary tests” which include the use of Both Glucose Fermentation Broth and Glucose O/F Medium include. The benzidine test which has been used effectively for the presence of iron-porphyrin compounds such as cytochromes and the true catalase enzyme. Some organisms possess the enzyme cytochrome a3 oxidase as part of the electron transport system in respiration; this enzyme is responsible for a positive reaction in the oxidase test where the dye tetramethyl-p-phenylenediamine is reduced to a purple compound.

Further tests (not indicated) would then be done to determine positively the genus identification and also the likely species. You can go where the experts are and consult the latest editions of Bergey’s Manual of Systematic Bacteriology and Bergey’s Manual of Determinative Bacteriology for more information. Bergey’s Manual of Systematic Bacteriology is a multi-volume set, and the first volume of the new, 2nd edition is out now but may not be specifically helpful for the organisms listed in the table below. Bergey’s Manual of Determinative Bacteriology is mainly used for identification, but the present 9th edition has become quite dated in that respect.

The idea for the format of the following table comes from the classic Cowan and Steel’s Manual for the Identification of Medical Bacteria, 2nd edition, revised by S. T. Cowan (1974, Cambridge University Press). This table of often-isolated chemoheterotrophic bacteria was put as a guide in targeting likely names of genera to pin on the “nature isolates.” An X marks the place where a certain pattern of characteristics matches up with a possible genus. Considering additional characteristics of the isolate, one can consult Bergey’s Manual or The Prokaryotes for this genus and related genera (oearby pages) for a more definitive identification.

Gram reaction
(young culture)

+

+

+

+

+

+

+

+

+

+

–

–

–

–

–

–

shape

 

 

coccus
(clusters)

coccus
(clusters)

coccus
(chains)

coccus
(tetrads)

rod

rod

irreg.
rod

rod

rod

rod

rod

rod

rod

rod

rod

coccus
(pairs)

aerobic growth

+

+

+

+

+

+

+

–

+

+

+

+

+

+

+

+

anaerobic growth

–

+

+

+

+

–

–

+

+

–

–

–

+

+

+

–

endospores

–

–

–

–

–

–

–

+

+

+

–

–

–

–

–

–

motility
(Motility Medium)

–

–

–

–

–

+

–

+
or –

+
or –

+
or –

+
or –

+
or –

–

+

+

–

catalase reaction

+

+

–

–

–

+

+

–

+

+

+

+

+

+

+

+

benzidine reaction

+

+

–

–

–

+

+

–

+

+

+

+

+

+

+

+

oxidase reaction

+

–

–

–

–

–

–

–

+
or –

+
or –

+

+

–

–

+

+

glucose fermentation to acid or to acid+gas

–

+

+

+

+

–

–

+ (or
–)

+

–

–

–

+

+

+

–

Glucose O/F Medium

 

 

 

 

 

 

 

 

 

 

–

O

F

F

F

O

Micrococcus

X

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

Staphylococcus

 

X

 

 

 

 

 

 

 

 

 

 

 

 

 

 

Streptococcus

 

 

X

 

 

 

 

 

 

 

 

 

 

 

 

 

Lactococcus

 

 

X

 

 

 

 

 

 

 

 

 

 

 

 

 

Enterococcus

 

 

X

 

 

 

 

 

 

 

 

 

 

 

 

 

Leuconostoc

 

 

X

 

 

 

 

 

 

 

 

 

 

 

 

 

Pediococcus

 

 

X

X

 

 

 

 

 

 

 

 

 

 

 

 

Aerococcus

 

 

 

X

 

 

 

 

 

 

 

 

 

 

 

 

Lactobacillus

 

 

 

 

X

 

 

 

 

 

 

 

 

 

 

 

Kurthia

 

 

 

 

 

X

 

 

 

 

 

 

 

 

 

 

Arthrobacter

 

 

 

 

 

 

X

 

 

 

 

 

 

 

 

 

Clostridium

 

 

 

 

 

 

 

X

 

 

 

 

 

 

 

 

Bacillus

 

 

 

 

 

 

 

 

X

X

 

 

 

 

 

 

Alcaligenes

 

 

 

 

 

 

 

 

 

 

X

 

 

 

 

 

Pseudomonas

 

 

 

 

 

 

 

 

 

 

 

X

 

 

 

 

Klebsiella

 

 

 

 

 

 

 

 

 

 

 

 

X

 

 

 

Shigella

 

 

 

 

 

 

 

 

 

 

 

 

X

 

 

 

Salmonella

 

 

 

 

 

 

 

 

 

 

 

 

 

X

 

 

Escherichia

 

 

 

 

 

 

 

 

 

 

 

 

 

X

 

 

most other
enteric genera

 

 

 

 

 

 

 

 

 

 

 

 

 

X

 

 

Aeromonas

 

 

 

 

 

 

 

 

 

 

 

 

 

 

X

 

Chromobacterium

 

 

 

 

 

 

 

 

 

 

 

 

 

 

X

 

Neisseria

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

X

 

 

The identification of bacteria is a careful and systematic process that uses many different techniques to narrow down the types of bacteria that are present in an unknown bacterial culture, such as the infected blood of someone dangerously ill with meningitis.

 

Identification techniques include:

· Morphological (according to the bacterial morphology);

· Cultural (according to the bacterial growth signs in/on different nutrient media);

· Biochemical (according to the bacterial ability to utilize differen substrates);

· Serological (according to the bacterial antigens);

· Bilological (according to the bacterial ability to cause different changes in laboratory animals after their inoculation by microbes);

· Flow cytometry;

· Phage typing;

· Protein analysis;

· Comparison of nucleotide sequenses.

 

Morphological identification (according to the bacterial morphology) – Microscopic morphology

 

A number of morphological characteristics are useful in bacterial identification.  These include the presence or absence of:

·                                                 cell shape

Описание: Описание: Описание: image022

Cocci

Описание: Описание: Описание: image032

Rods

·                                                 cell size

·                                                 endospores

Описание: Описание: Описание: image030

Spores

·                                                 flagella

Описание: Описание: Описание: image037

Flagella

·                                                 glycocalyx

·                                                 etc.

The techniques used at the earliest stages are relatively simple. An unknown sample may contain different bacteria, so a culture is made to grow individual bacterial colonies. Bacteria taken from each type of colony is then used to make a thin smear on a glass slide and this is examined using a light microscope. Viewing the bacteria shows if they are cocci or bacilli or one of the rarer forms, such as the corkscrew shaped spirochaetes.

 

Gram Staining

Cocci and bacilli can be either gram positive bacteria or gram negative bacteria, depending on the structure of their cell wall. The Gram Stain is named after Hans Christian Gram, a bacteriologist from Denmark who developed the technique in the 1880s. The test is performed on a thin smear of an individual bacterial colony that has been spread onto a glass slide. Gram positive bacteria retain an initial stain, crystal violet, even when the bacterial smear is rinsed with a mixture of acetone and ethanol. The solvent removes the dark blue colour from gram negative bacteria, dissolving away some of the thin cell wall. When a second stain, a pink dye called fuchsin is then added, gram positive bacteria are unaffected by this, as they are already stained dark blue, but the gram negative bacteria turn bright pink. The colour difference can be seen easily using a light microscope.

Gram stain

 

·  Place a drop of sterile water on a microscope slide.

·  Make a light suspension of test culture in the water.

·  Allow to dry then fix the film by passing the slide three or four times through a Bunsen flame with the film uppermost.

·  Allow to cool.

·  Flood slide with crystal violet and allow to react for 60 seconds.

·  Wash with water.

·  Flood with Lugol’s (or Gram’s) iodine for 60 seconds.

·  Wash as before and drain off excess water.

·  Decolourise with acetone and wash off immediately.

·  Counterstain with dilute carbol fuchsin for 30 seconds.

·  Wash and blot dry.

 

Описание: Описание: Описание: Gram_positiveОписание: Описание: Описание: gram_negat_fusobact

Gram-positive (left) and gram-negative (right) microbes

 

Acid Fast Bacteria

Spirochaetes such as the Mycobacteria that cause tuberculosis and leprosy do not stain well using the Gram Stain. Other stains that do not wash away with dilute acid are used instead. The bacteria are deeply stained, either bright red against a blue background or red against a green background. Because the stain cannot be removed by washing with acid, organisms stained by these methods are termed acid-fast bacteria.

 

Ziehl Neelsen Stain

 

·  Flood a fixed slide with strong carbol fuchsin.

·  Heat the slide until it steams and keep steaming for 5 minutes

·  Warning Do NOT BOIL.

·  Do NOT do this with acetone being used in the same sink.

·  Do NOT allow the slide to dry out.

·  Wash slide with water (preferably filtered water; tap water may contain mycobacteria leading to false positive results).

·  Treat with 3% acid alcohol for 10 minutes or until only a suggestion of pink remains on the film.

·  Wash film with water.

·  Counterstain for 15-30 seconds with methylene blue.

·  Wash and blot dry.

Acid-fast bacilli appear bright red while tissue cells and other bacteria stain blue.

 

Описание: Описание: Описание: image025

This stains acid-alcohol fast bacteria, e.g. mycobacteria.

 

 

Spore Stain (Modified Ziehl Neelsen method)

 

·  Stain the fixed film with strong carbol fuchsin for 3-5 minutes, heating until steam rises.

·  Wash with water.

·  Treat with 0.25% sulphuric acid for 15-60 seconds.

·  Wash with water.

·  Counterstain with 1% aqueous methylene blue for 5 minutes.

·  Wash and blot dry.

 

Описание: Описание: Описание: image060

Bacterial spores are seen as red structures: vegetative cells stain blue.

 

Описание: Описание: Описание: spore

Bacterial spores (Schaeffer-Fulton stain technique)

 

Motility

 

·  Place a drop of liquid culture on a microscope coverslip.

·  Invert over a plasticine ring on a microscope slide.

·  Examine under x40 objective (high power dry lens).

·  Accidental spills may occur during this procedure.

 

 

Описание: Описание: Описание: image061

Wet mount technique

Описание: Описание: Описание: image062

Описание: Описание: Описание: motility

Left – negative test, right – positive

 

Capsule staining (relief staining with eosin)

 

·  Place a drop of broth culture on one end of a microscope slide.

·  Add one drop of eosin solution and leave for one minute.

·  Take a second slide and draw its edge back to contact the stained suspension.

·  Holding the second slide at 45 degrees, spread a thin layer of fluid along the first slide by a continuous forward movement.

Allow the film to air dry then examine under oil-immersion. 

 

Описание: Описание: Описание: capsule

Background material and cells stain red. Capsular material appears as an unstained halo around the cells

 

Aerobic or Anaerobic?

Finding out whether bacteria are aerobic or anaerobic helps separate them into different categories. It is relatively easy to discover whether a bacterial culture grows in the presence or absence of oxygen. Bacteria that only grow if oxygen is available are called aerobic bacteria. Anaerobic bacteria can grow without oxygen, and some species are killed by oxygen, only surviving in completely oxygen-free environments. These species are described as obligate anaerobes (see above)

 

Cultural (according to the bacterial growth signs in/on different nutrient media) – colony morphology

Описание: Описание: Описание: image031

Описание: Описание: Описание: Bacterial_colony_morphology

Описание: Описание: Описание: mixed_colony

Mixed colonies

 

Biochemical (according to the bacterial ability to utilize differen substrates) – Enzyme Tests

Within broad types of bacteria, individual species have different metabolic systems and are able to grow using a range of nutrients. Testing bacteria to find out whether they are positive or negative for specific enzymes helps narrow down their identity. For example, Staphylococcus aureus tests positive for the enzyme coagulase, but Staphylococcus epidermidis is negative for this enzyme.

Fermentative properties of microbes are used in the  laboratory diagnosis of infectious diseases, and in studying microbes of the soil, water, and air.

Описание: Описание: Описание: image039

To identify the isolated pure culture, supplement the study of morphological, tinctorial, and cultural features with determination of their enzymatic and antigenic attributes, phago- and bacterio-cinosensitivity, toxigenicity, and other properties characterizing their species specificity.

To demonstrate carbohydrate-splitting enzymes, Hiss’ media are utilized. When bacteria ferment carbohydrates with acid formation, the colour of the medium changes due to the indicator present in it. Depending on the kind and species of bacteria studied, select media with respective mono- and disaccharides (glucose, lactose, maltose, sucrose), polysaccharides (starch, glycogen, inulin), higher alcohols (glycerol, mannitol). In the process of fermentation of the above sub­stances aldehydes, acids, and gaseous products (CO2, H2, etc.) are formed.

Описание: Описание: Описание: carb%20ferm

 

 

 

TSI (Triple Sugar Iron) and KIA (Kligler’s Iron Agar)

Triple Sugar Iron Agar (TSI) and Kligler’s Iron Agar (KIA) are used to determine if bacteria can ferment glucose and/or lactose and if they can produce hydrogen sulfide or other gases. (If an organism can ferment glucose, it is “glucose positive”. If it ferments lactose, it is “lactose positive”.) In addition, TSI detects the ability to ferment sucrose. These characteristics help distinguish various Enterobacteriacae, including Salmonella and Shigella, which are intestinal pathogens.

TSI contains three sugars: glucose, lactose and sucrose. Lactose and sucrose occur in 10 times the concentration of glucose (1.0% versus 0.1%). Ferrous sulfate, phenol red (a pH indicator that is yellow below pH 6.8 and red above it), and nutrient agar are also present. The tube is inoculated by stabbing into the agar butt (bottom of the tube) with an inoculating wire and then streaking the slant in a wavy pattern. Results are read at 18 to 24 hours of incubation.

Reading the Results

A yellow slant on TSI indicates the organism ferments sucrose and/or lactose. On KIA a yellow slant indicates the organism ferments lactose. (Because KIA does not contain sucrose, sucrose fermentation is not detected with KIA tests.) Other results are the same for TSI and KIA. A yellow butt shows that the organism fermented glucose. Black preciptate in the butt indicates hydrogen sulfide production.  Production of gases other than hydrogen sufide is indicated either by cracks or bubbles in the media or the media being pushed away from the bottom of the tube.    

Understanding the Results 

If an organism ferments glucose only, the entire tube turns yellow due to the effect of the acid produced on phenol red. Because there is a minimal amount of glucose present in the tube, the organism quickly exhausts it and begins oxidizing amino acids for energy. Ammonia is thus produced and the pH rises. Within 24 hours the phenol red indicator reverts to its original red color on the slant. Because TSI/KIA media is poured as a deep slant, the butt has limited oxygen and bacteria are unable to oxidize amino acids there. The butt thus remains yellow.

If an organism can ferment lactose and/or sucrose, the butt and slant will turn yellow (as they do from glucose fermentation). However, they remain yellow for at least 48 hours because of the high level of acid products produced from the abundant sugar(s).  

KIA resembles TSI in all respects except that KIA contains two sugars (lactose and glucose) while TSI contain three sugars (lactose, glucose and sucrose). Like TSI media, KIA contains 10 times as much lactose as glucose. Thus KIA tests for an organism’s ability to ferment glucose or lactose but not sucrose. 

If the gas being produced is hydrogen sulfide (H2S), it reacts with the ferrous sulfate and preciptates out as a black precipitate (ferric sulfide) in the butt. Organisms producing large amounts of hydrogen sulfide (e.g. Salmonella and Proteus) may produce so much black precipitate that it masks the yellow (acid) color of the butt.

 

Описание: Описание: Описание: kia_1

1. Reading results

 

Описание: Описание: Описание: KIA2

2. Interpreting results on TSI

 

Описание: Описание: Описание: kia3

3. Interpreting results on KIA

 

To demonstrate proteolytic enzymes in bacteria, transfer the lat­ter to a gelatin column. Allow the inoculated culture to stand at room temperature (20-22 °C) for several days, recording not only the development of liquefaction per se but its character as well (lami­nar, in the form of a nail or a fir-tree, etc.).

Описание: Описание: Описание: gelatin1Описание: Описание: Описание: gelatin%20negative

Serratia marcescens on the left is positive for gelatinase production, as evidenced by the liquidation of the media. 

Salmonella typhimurium on the right is negative, as evidenced by the solidity of the media.

 

Proteolytic action of enzymes of microorganisms can also be ob­served following their streaking onto coagulated serum, with depres­sions forming around colonies (liquefaction). A casein clot is split in milk to form peptone, which is manifested by the fact that milk turns yellowish (milk peptonization).

More profound splitting of protein is evidenced by the formation of indol, ammonia, hydrogen sulphide, and other compounds. To detect the gaseous substances, inoculate microorganisms into a meat-peptone broth or in a 1 per cent peptone water. Leave the inocula­ted cultures in an incubator for 24-72 hrs.

To demonstrate indol by Morel’s method, soak narrow strips of filter paper with hot saturated solution of oxalic acid (indicator pa­per) and let them dry. Place the indicator paper between the test tube wall and stopper so that it does not touch the streaked medium. When indol is released by the 2nd-3rd day, the lower part of the pa­per strip turns pink as a result of its interaction with oxalic acid.

The telltale sign of the presence of ammonia is a change in the col­our of a pink litmus paper fastened between the tube wall and the stopper (it turns blue).

Hydrogen sulphide is detected by means of a filter paper strip saturated with lead acetate solution, which is fast­ened between the tube wall and the stopper. Upon interaction be­tween hydrogen sulphide and lead acetate the paper darkens as a re­sult of lead sulphide formation.

Описание: Описание: Описание: R_24_ciрководень

 

To determine catalase, pour 1-2 ml of a 1 per cent hydrogen per­oxide solution over the surface of a 24-hour culture of an agar slant. The appearance of gas bubbles is considered as a positive reaction. Use a culture known to contain catalase as a control.

The reduction ability of microorganisms is studied using methylene blue, thionine, litmus, indigo carmine, neutral red, etc. Add one of the above dyes to nutrient broth or agar. The medium decolourizes if the microorganism has a reduction ability. The most widely em­ployed is Rothberger’s medium (meat-peptone agar containing 1 per cent of glucose and several drops of a saturated solution of neutral red). If the reaction is positive, a red colour of the agar changes into yellow, yellow-green, and fluorescent, while glucose fermentation is characterized by cracks in the medium.

 

Bile solubility test (Pure culture)

 

·  Emulsify a few colonies of the test culture in 1ml of saline to form a smooth suspension.

·  Add one drop of 10% sodium deoxycholate solution.

·  Incubate at 37oC.

·  Examine for clearing at 15 minutes, 30 minutes and 60 minutes.

Clearing should occur within 30 minutes

In a mixed culture place one drop of 10% sodium deoxycholate solution onto the test colony..

 

Описание: Описание: Описание: bile

This should lyse within 30 minutes. This method is not entirely reliable, and it is better to purify any suspected colony

 

Catalase Test

 

·  Using a glass capillary tube, pick a small amount of culture from the plate.

·  If possible do not pick from a blood containing medium as the presence of catalase in the medium itself may give a false positive result. This sometimes cannot be avoided.

·  Carefully invert the tube and insert it into the hydrogen peroxide solution.

·  Tilt the tube so the fluid flows onto the culture material.

·  Look for the immediate formation of oxygen bubbles in the tube indicating the activity of catalase.

 

Описание: Описание: Описание: catalase3

Описание: Описание: Описание: Catalase_positiveОписание: Описание: Описание: catalase_negative

 

Catalase test positive (left) and negative (right)

 

Описание: Описание: Описание: catalase4

 

Catalase test

 

Coagulase Test

 

A. Slide method:

This test detects the presence of “clumping factor” and is not a true coagulase test.

·  Place three separate drops of saline on a clean slide.

·  Suspend a loopful of test colony in two of these, and a loopful of control Staphylococcus aureus in the third.

·  With a sterile loop, add a drop of citrated rabbit plasma to one test and the control suspension.

·  Clumping occurring within 10 seconds indicates a positive result.

·  The saline control should remain evenly suspended.

B. Tube method:

·  Emulsify a few colonies of control Staphylococcus aureus and the test isolate into appropriately labelled tubes containing a 1/10 dilution of plasma in 0.85% saline.

·  Incubate at 37oC.

·  Examine for coagulation at 1, 3 and 6 hours.

 

 

Описание: Описание: Описание: plasmocoagulase

Conversion of the plasma into a soft or stiff gel, seen on tilting the tube to a horizontal position indicates a positive result.

 

DNase Test

 

·  Inoculate sections of tryptose agar medium containing DNA with material from test colonies.

·  Controls of known Staphylococcus aureus and Staphylococcus epidermidis should be inoculated as positive and negative controls.

·  Incubate the plate at 37oC for 18-24 hours.

·  Flood the plate with lM HCl that precipitates DNA and turns the medium cloudy.

 

 

Описание: Описание: Описание: DNAse

The presence of a zone of clearing round the area of growth indicates DNase production that has hydrolysed the DNA.

 

Lecithinase activity results in the production of an opaque zone of precipitation around the area of growth. This precipitation should not be present on that side of the plate previously inoculated with specific α-antitoxin.

Nagler Test

 

Clostridium perfringens elaborates a variety of exotoxins, one of which is α-toxin (lecithinase or phospholipase C). The following test is used to demonstrate production of this specific toxin.

·  Divide an egg yolk plate into two equal sections.

·  Spread a loopful of Clostridium perfringens antitoxin over half the plate and allow to dry.

·  With a single streak, inoculate the plate with a loopful of the test culture, beginning on the untreated side of the plate.

·  Incubate at 37oC under anaerobic conditions.

 

 

Описание: Описание: Описание: lecitinase1

 

Описание: Описание: Описание: lecitinase

Lecithinase activity results in the production of an opaque zone of precipitation around the area of growth. This precipitation should not be present on that side of the plate previously inoculated with specific α-antitoxin

Optochin Test

 

·  Divide a blood agar plate into three equal sections.

·  Inoculate one with a known Streptococcus pneumoniae, another with a viridans streptococcus and the third with the test isolate.

·  Care must be taken to keep the cultures separate.

·  Place a 5 microgram Optochin disc (ethylene hydrocupreine hydrochloride) in the centre of the plate.

·  Incubate at 37oC overnight and observe the zone of inhibition.

 

Описание: Описание: Описание: optochin

 

Oxidase Test

 

·  Dip a sterile swab in freshly prepared oxidase reagent (1% tetra methyl-para-phenylene diamine dihydrochloride) then touch the target colony. A positive reaction is indicated by the rapid appearance of a purple colour on the swab where the test bacteria adhere.

Описание: Описание: Описание: oxydase_test1

 

Alternatively

·  Place a drop of freshly prepared oxidase reagent (1% tetra methyl-para-phenylene diamine dihydrochloride) on a piece of filter paper in a Petri dish or on a glass slide.

·  Leave for 1 minute.

·  Using a wooden stick or a glass slide (not a wire loop) rub a small amount of the test colony onto the moistened paper.

·  Again, a positive test is indicated by the rapid appearance of a purple colour at this site.

 

Описание: Описание: Описание: oxidase%20test

 

 

Indole production – measure the ability to hydrolyse and deaminate tryptophan

– Klesiella-enterobacter-salmonella-serratia are mostly negative

– positive-red colour

Описание: Описание: Описание: indole1

 

Methyl red  – methyl red, a pH indicator with a range between 4.4(red) and 6.0(yellow)

– only species that produce suffiicient acids can maintian the pH at below4.4 against the buffer system of the test medium

– most species of Enterobacteriaceae produce strong acids. Enterobacter-serratia do not produce enough acids

 

Описание: Описание: Описание: metil_red2

Описание: Описание: Описание: Methyl%20red

Positive-stable red colour in the surface layer of the medium

 

Voges-proskauer reaction test

-this test is based on the conversion of acetoin to a red coloured complex through the action of KOH, atmospheric 02 and alpha napthol

–Klesiella-enterobacter-serratia is able to perform this pathway

–

 

Описание: Описание: Описание: Vp
Voges-proskauer reaction test. Red colour at the surface of the medium after 15 mins following the addition of reagents

 

 

Citrate utilisation test – some bacteria have the ability to utilize citrate as the sole carbon sourc and turn the medium allkaline due to production of ammonia

–Escherichia-Edwardisella-shigella-salmonella cannot utilise citrate as the sole source of carbon

 

 

Описание: Описание: Описание: citrate

Описание: Описание: Описание: Citrates

Positive – from colour green to blue

 

Urease test – some species posses the enzyme urease and able to hydrolyze urea with the release of ammonia and carbon dioxide

– this is used mainly to differentiate urease positive Proteus species from other member of Enterobacteriaceae

– positive-yellowish orange to pink

 

Описание: Описание: Описание: urea1

Описание: Описание: Описание: Urease_Test
Positive – yellowish orange to pink



The API-20E test kit for the identification of enteric bacteria (bioMerieux, Inc., Hazelwood, MO) provides an easy way to inoculate and read tests relevant to members of the Family Enterobacteriaceae and associated organisms. A plastic strip holding twenty mini-test tubes is inoculated with a saline suspension of a pure culture (as per manufacturer’s directions). This process also rehydrates the dessicated medium in each tube. A few tubes are completely filled (CIT, VP and GEL as seen in the photos below), and some tubes are overlaid with mineral oil such that anaerobic reactions can be carried out (ADH, LDC, ODC, H2S, URE).

After incubation in a humidity chamber for 18-24 hours at 37°C, the color reactions are read (some with the aid of added reagents), and the reactions (plus the oxidase reaction done separately) are converted to a seven-digit code. The code is fed into the manufacturer’s database via touch-tone telephone, and the computer voice gives back the identification, usually as genus and species. The reliability of this system is very high, and one finds systems like these in heavy use in many food and clinical labs.

Note: Discussion and illustration of the API-20E system here does not necessarily constitute any commercial endorsement of this product. It is shown in our laboratory courses as a prime example of a convenient multi-purpose testing method one may encounter out there in the “real world.”

In the following photos:

·  Note especially the color reactions for amino acid decarboxylations (ADH through ODC) and carbohydrate fermentations (GLU through ARA).

o          The amino acids tested are (in order) arginine, lysine and ornithine. Decarboxylation is shown by an alkaline reaction (red color of the particular pH indicator used).

o          The carbohydrates tested are glucose, mannitol, inositol, sorbitol, rhamnose, sucrose, melibiose, amygdalin and arabinose. Fermentation is shown by an acid reaction (yellow color of indicator).

 

·  Hydrogen sulfide production (H2S) and gelatin hydrolysis (GEL) result in a black color throughout the tube.

·  A positive reaction for tryptophan deaminase (TDA) gives a deep brown color with the addition of ferric chloride; positive results for this test correlate with positive phenylalanine and lysine deaminase reactions which are characteristic of Proteus, Morganella and Providencia.

In the first set of reactions:

·  Culture “5B” (isolated from an early stage of sauerkraut fermentation) is identified as Enterobacter agglomerans which has been a convenient dumping ground for organisms now being reassigned to better-defined genera and species including the new genus Pantoea. This particular isolate produces reddish (lactose +), “pimply” colonies on MacConkey Agar which exude an extremely viscous slime as may be seen here; this appearance is certainly atypical of organisms identified as E. agglomerans or Pantoea in general.

·  Culture “8P44” is identified as Edwardsiella hoshinae. The CDC had identified this culture (in 1988) as the ultra-rare Biogroup 1 of Edwardsiella tarda which may not be in the API-20E database. This system probably would not be able to differentiate between these two organisms.

 

Описание: Описание: Описание: http://www.jlindquist.net/generalmicro/GBimages/API1.jpg

 

Описание: Описание: Описание: http://www.jlindquist.net/generalmicro/GBimages/API2.jpg

 

 

Serological identification (according to the bacterial antigens)

All immunological tests are based on specific antibody-antigen interaction. These tests are called serological since to make them one should use antibody-containing sera.

Serological tests are employed in the following cases: (a) to deter­mine an unknown antigen (bacterium, virus, toxin) with the help of a known antibody; (b) to identify an unknown antibody (in blood serum) with the help of a known antigen. Hence, one component (ingredient) in serological tests should always be a known entity.

The main serological tests include tests of agglutination, precipi­tation, lysis, neutralization, and their various modifications.

 

Agglutination Tests

Every individual species of bacterium has a unique collection of 3D shapes on its surface, called antigens. These are formed by the molecules on the outside of the cell wall. When a bacterium infects a human or an animal, the immune system reacts to these antigens, making a specific antibody to each one. Antiserum raised against a known bacterial species can therefore be used to positively identify if that species is present in an unknown culture. A small amount of different antiserum, specific for different bacteria, is used to test a sample. When the result is positive, the bacteria clump together, or agglutinate; when the result is negative, no clumping occurs.

 

Lancefield Grouping (Streptex Method)

 

·  Emulsify a loopful of the test culture in 0.4 ml of extraction enzyme.

·  Incubate at 37oC for 1 hour.

·  Add one drop of latex reagent to the appropriate circle of a black tile.

·  Next, add one drop of extract to each circle and mix, using a wooden stick.

·  Rock gently for one minute.

·  Clumping indicates a positive reaction.

 

Presumptive agglutination test. A presumptive AT is performed on glass slides. Using a Pasteur pipette, transfer several drops of se­rum of low (1:10-1:20) dilutions and a drop of isotonic saline for control on a grease-free glass slide. Into each drop of the serum as well as in the control drop, inoculate a loopful of 24-hour living culture of the microorganism picked from the surface of a solid nut­rient medium or pipette one drop of the suspension of dead microor­ganisms (diagnosticum). The inoculated culture is thoroughly mixed until the drop of liquid is uniformly turbid.

The reaction takes place at room temperature. Inspect visually the results in 5-10 min; occasionally one may use a 5 X magnifying lens for this purpose. If the glass slides are placed into a humid closed chamber to prevent evaporation, the results of the test may be read in 30-40 min as well.

A positive test is indicated by the appearance in the drop with serum of large or small flakes, readily visible upon rocking of the cover-slip. In a negative test, the fluid remains uniformly turbid.

Описание: Описание: Описание: Agglut

 

Slide agglutination

 

In cases where the number of microorganisms is small and the re­sults of the test are difficult to interpret, dry the drop of the inocu­lated serum, fix the preparation, stain it with Pfeifier’s fuchsine, and study under the microscope. In a positive test, a microscopic field is largely free of microorganisms but they are accumulated in some places. In a negative test, microorganisms are uniformly distributed throughout the microscopic field. This test is known as microagglutination.

 

Bilological identification

Biological examination. Biological study consists of infecting animals for the purpose of isolating the culture of the causative agents and their subsequent examination for pathogenicity and virulence.

Choice of experimental animals depends on the aim of the study. Most frequently used are rabbits, guinea pigs, albino mice, and albino rats. This is explained by the fact that they are susceptible to the causative agents of various infections diseases in man, easy to handle, and propagate readily. Hamsters, polecats, cotton rats, monkeys, birds, etc. may also be occasionally infected.

Specialized, particularly virological, laboratories, make use of genetically standardized, so-called inbred animals (mice, rabbits, guinea pigs, and others).

Working with experimental animals, one should keep it in mind that they may have spontaneous bacterial and viral diseases and latent infections activated as a result of additional artificial in­oculation. This hinders the isolation of pure culture of the causative agent and determination of its aetiological role. Gnotobiotes (without microflora) and animals free of pathogenic microorganisms have no such drawback. Currently they include chickens, rats, mice, guinea pigs, pigs, etc.

Laboratory animals are distinguished by their species, age, and individual sensitivity toward microorganisms. Thus, in selecting animals for study it is necessary to take into account their species and age. For instance, sensitivity in mongrel animals may show con­siderable individual variations. The use of inbred animals with a definite constant susceptibility toward microorganisms excludes individual variations in sensitivity and allows for reproducible re­sults.

Animals are infected for .isolating pure culture of the causative agent in cases where it is impossible to obtain it by any other method (for example, in contamination of the studied objects by extra­neous microflora which inhibits growth of the causative agent and in case of insignificant amounts of microorganisms or their trans­formation into filtering forms). Thus, in studying decayed corpses of rodents for the presence of plague causative agents, one inoculates (with suspension of the organs or blood) guinea pigs which die 3-7 days later with manifestations of septicaemia. Pure culture of the causative agent is readily isolated from the blood of internal organs.

Contamination of susceptible animals for reproducing the infec­tious process is used in diseases caused by Rickettsia and viruses.

Injection to mice of material from a patient with tickborne enceph­alitis brings about paralysis and death in these animals. To de­termine pathogenicity and virulence of the causative agents of plague, tularaemia, botulism, anthrax, and some viral diseases, cultures obtained from patients arc inoculated into albino mice, guinea pigs. rats, or suckling mice.

Описание: Описание: Описание: image199

Mouse with tetanus signs

 

Описание: Описание: Описание: image201

Guinea pig with botulism signs

 

Phage Typing. Bacteriophage (or phage ) are viruses that infect bacteria. Phage can be very specific in what bacteria they infect and the pattern of infection by many phage may be employed in phage typing to distinguish bacterial species and strains. The molecules on the surface of the bacterial cell are also targets for bacteriophages (phages for short). These are viruses that infect bacteria and that associate with different bacterial species very specifically. It is therefore possible to identify bacteria by investigating which bacteriophages can bind to their surface.

Описание: Описание: Описание: image045

 

Protein analysis [gel electrophoresis, SDS-PAGE, establishment of clonality]

I. The size and other differences between proteins among different organisms may be determined very easily employing methods of protein separation using methods collectively known as gel electrophoresis.

II.                                                        SDS-PAGE:

· One popular technique goes by the name SDS-PAGE which stands for sodium dodecyl sulfate-polyacrylamide gel electrophoresis

· Note that another name for SDS is sodium lauryl sulfate, a detergent you will find in many shampoos.

Such methods are very good at detecting small differences between isolates and are especially good at establishing clonality.

 

Protein and DNA Sequencing

In the last 25 years, molecular biology has developed rapidly and it is now possible to sequence the proteins from different bacterial species, make large databases of the sequences, and use them as very powerful identification tools. Similar database have been developed for bacterial DNA and bacterial RNA, particularly the RNA that forms the structural components of bacterial ribosomes.

Such techniques are also being used to follow the development of strains of bacterial species that are currently evolving at a very rapid rate. Strains of Chlamydia trachomatis, for example, are known to be exchanging large numbers of genes, forming completely new strains in a very short time. This is worrying – this bacterium is responsible for taking the sight of 8 million people living in developing countries today. Identifying the new strains and studying how they have arisen so quickly is crucial to controlling infection and preventing new cases of blindness.

There are a few basic things regarding 16S ribosomal RNA gene analysis. The actual mechanics of the various parts of this test can be found elsewhere on the web or in an up-to-date textbook, and they may be summarized here in the future. With this comparative test, differences in the DNA base sequences between different organisms can be determined quantitatively, such that a phylogenetic tree can be constructed to illustrate probable evolutionary relatedness between the organisms.

The nucleotide base sequence of the gene which codes for 16S ribosomal RNA is becoming an important standard for the definition of bacterial species. Comparisons of the sequence between different species suggest the degree to which they are related to each other; a relatively greater or lesser difference between two species suggests a relatively earlier or later time in which they shared a common ancestor.

A comparison between eleven species of gram-negative bacteria is illustrated on a separate sequence comparison page, where the sequences are aligned such that similarities and differences can be readily seen when one scrolls to the right or left. Gaps and insertions of nucleic acid bases (the result of “frame-shift” mutations occuring over eons of time as the organisms diverge from common ancestors) which affect long stretches of DNA have to be taken into account for a proper alignment.

In an earlier version of the above-mentioned sequence comparison page, when only four species were compared with each other, a relatively short segment stood out as appearing to be “frame-shifted” when comparing Pseudomonas fluorescens with a group of three enterics. This situation is shown as follows with the nucleotide bases of the segment in question shown in red.

Pseudomonas fluorescens

…gctaataccgcatacgtcctacgggagaaagcagggg…

Our new organism, shown below as “AH”

…gctaataccgcataacgtcgcaagaccaaagcggggg…

Budvicia aquatica

…gctaataccgcgtaacgtcgaaagaccaaagcggggg…

Edwardsiella tarda

…gctaataccgcataacgtcgcaagaccaaagtggggg…

One can surmise that a frame-shift mutation – if the bases are not misplaced to the extent that the mutation becomes silent or lethal – could be a “cheap” way to effect a major change in the genotype and subsequent phenotype – perhaps resulting in one of those infamous “leaps” in evolution one hears conjectured about from time to time. Even though the specific sequence within a shifted segment of DNA may not be changed, the shift will result in the nucleotide bases being re-grouped into different triplet codes and read accordingly, and the resulting gene may produce a vastly different protein which can change the appearance or function of a cell to a significant extent. So, when sequences between two species are compared, the organisms may appear to be a bit more closely related if these relatively short frame-shifted segments were taken into consideration. (With long stretches of DNA, one would not expect independant genes farther along the chromosome to be affected.)

When a 1308-base stretch of that part of the chromosome which codes for 16S ribosomal RNA was lined up and analyzed (“manually” when I had a little time to kill) to find the extent to which the above four organisms differed from each other, the percent difference between any two organisms was determined, and the results are summarized as follows:

 PF 

 PF 

 

 AH 

 14.8*

 AH 

 

 BA 

14.5

3.2

 BA 

 

 ET 

14.9

4.3

5.0

 ET 

* An example: The same bases appear in the same sequence, position by position, for each of the two organisms except for 14.8% of the time.

With the percent differences used to denote probable evolutionary distances between the organisms, a phylogenetic tree was roughed out to illustrate the relationships. The distances between any two organisms, when read along the horizontal lines, corresponds closely to the percent differences. (The bar at the bottom signifies approximately 1% base difference.)

Описание: Описание: Описание: http://www.jlindquist.net/generalmicro/GBimages/tree4.jpg

Databases of various gene sequences are found on the web. Genbank’s database was used as the source of the above sequences. And rather than having to line up the sequences and determine the differences manually, a set of programs to analyze sequence data and plot trees are available.

 

 

 

Leave a Reply

Your email address will not be published. Required fields are marked *

Приєднуйся до нас!
Підписатись на новини:
Наші соц мережі