June 22, 2024
0
0
Зміст

Methods of examination of bacterial antibiotic susceptibility. The main principles of rational antibiotic therapy of diseases.

Methods of sterilization and disinfection.

 

 

 

[Strict or Obligate] Aerobe: An organism that is capable of using oxygen as a terminal electron acceptor [i.e., aerobic respiration], can tolerate a level of oxygen equivalent to or higher than that present in an air atmosphere (21% oxygen), and has a strictly respiratory type of metabolism. Some aerobes may also be capable of growing anaerobically with electron acceptors other than oxygen [i.e., anaerobic respiration].

 

Facultative anaerobe: An organism that can grow well both in the absence of oxygen and in the presence of a level of oxygen equivalent to that in an air atmosphere (21% oxygen). Some are capable of growing aerobically by respiring with oxygen and anaerobically by fermentation [anaerobic respiration is also possible]; others have a strictly fermentative type of metabolism and do not respire with oxygen. We form the “aerotolerant anaerobe” category with the latter type; see below.]

 

Microaerophile: An organism that is capable of oxygen-dependent growth but cannot grow in the presence of a level of oxygen equivalent to that present in an air atmosphere (21% oxygen). Oxygen-dependant growth [i.e., aerobic respiration] occurs only at low oxygen levels. In addition to being able to respire with oxygen, some microaerophiles may be capable of respiring anaerobically with electron acceptors other than oxygen.

 

[Strict or Obligate] Anaerobe: An organism that is incapable of oxygen-dependent growth and cannot grow in the presence of an oxygen concentration equivalent to that present in an air atmosphere (21% oxygen). Some anaerobes may have a fermentative type of metabolism; others may carry out anaerobic respiration in which a terminal electron acceptor other than oxygen is used. [The primary consideration for defining an organism as a strict anaerobe is its total intolerance of oxygen.]

 

With these Bergey’s Manual definitions, phototrophs would be categorized with difficulty if at all. As one example, the purple non-sulfur photosynthetic bacteria can respire and can also grow anaerobically, but anaerobic growth is associated with the organisms’ use of energy derived from light, not (except for certain exceptional strains and species) from fermentation or anaerobic respiration.

 

 

For successfully cultivating anaerobes it is necessary to seed a large amount of material into the nutrient medium. The nutrient medium should have a certain viscosity which is attained by adding 0.2 per cent agar. The air is removed by boiling prior to seeding, and to inhibit thesubsequent entry of air, the medium is covered with a layer of oil 0.5-1 cm thick. Anaerobiosis is obtained by the adsorption of oxygen on porous substances (pumice, cotton wool, coal) and by adding reducing substances (carbohydrates, peptone, cysteine. pieces of liver, spleen, kidneys, brain, etc.). After seeding, the test tubes are filled up with liquid vaseline. Growth of the anaerobes is usually carried out on a Kitt-Tarozzi

 

The tested materials are boiled of short duration or heat on 80 0C for destroy bacteria without spores. The spores of microorganisms leave still alive and ater reinoculate this materials they are grown.

Fortner method. The agar media is divided  into two parts. Onto the one part inoculate E.coli or Serratia marcescens (these microorganisms absorb intensively oxygen) and onto second part  taested material. Closely  stop up this Petri dish  by parafin and put down into the thermostat. This method is used for obtainig anerobe culture.

 

 

 

Isolation and Identification of Pure Culture of Anaerobic Bacteria

 

Methods of obtaining anaerobic conditions. Taking into account that free molecular oxygen is toxic for obligate anaerobic bacteria, the main condition of such microorganisms cultivation is limitation of its access. There are some methods (mechanical, physical, biological) which allow providing it.

Toxic forms of oxygen

•  Certain oxygen derivatives are toxic to microorganisms.

•  Oxygen in its ground state is triplet oxygen (3O2).

•  Toxic forms of oxygen include singlet oxygen 1O2,

(superoxide anion) O2-, hydrogen peroxide H2O2 and hydroxyl radical (OH-).

As molecules have an unpaired electron, they are very reactive and cause destruction.

 

Enzymes that destroy toxic oxygen

·                                             Enzymes are present in cells that caeutralise most toxic forms of oxygen.

·                                             Catalase

·                                             Peroxidase

·                                             Superoxide dismutase

 

Physical methods. 1. Before inoculation of bacteria on/iutrient media it is necessarily to regenerate them for deletion of surplus oxygen (boiling them for 15-20 min in water bath, quickl cooling to the necessary temperature).

2. For warning oxygen penetration into nutrient medium it must be covered with the layer of sterile vaseline oil or paraffin (for liquid media).

3. A column of nutrient media in test tubes must be quite high (10-12 cm). Oxygen, as a rule, penetrates into the column of medium on a depth up to 2 cm, that is why favourable conditions for cultivation of anaerobic microbes create below.

Описание: Column_agar_anaer

 

4. An evacuation and replaceable method foresees the use of anaerobic jar. They are hermetically sealed metallic or plastic jars from which it is possible to pump out oxygen and replace it by special gases (helium, nitrogen, argon). Triple gas mixture which consists of nitrogen 80 %, carbon dioxide 10 %, and hydrogen 10 % is used. Sometimes natural gas may be used. For a deoxygenation in the jar palladic catalysts are used. For absorption of aquatic steams calcium chloride, silicagel and others substances are used in the jars.

Описание: jar1

 

5. Place the burning candle into the flask or jar with Petri plates.

Описание: свеча

Chemical methods foresee the use of substances absorb an oxygen (alkaline solution of pyrogallol, sodium hydrosulphite (Na2S2O4).

There may be used special reduced substances: cysteine (0,03-0,0,5 %), thioglycolic acid or sodium thioglycolate (0,01-0,02 %), sodium sulphide, ascorbic acid (0,1 %), different sugars.

Such functions have pieces of animals parenchymatous organs (liver, kidneys, heart) or even plants (potato).

The degree of deoxygenation or degree of nutrient medium reduction may be measured by indicators (rezazurine, neutral red, phenosafranine).

3. Use of the special gas generating systems which allow to create oxygen-free conditions in the jars, transport plastic packages and so on. One of most widespread there is the system of “Gas Generating Box”.

The GasPak™ EZ Gas Generating Pouch Systems are single-use systems that produce atmospheres suitable to support the primary isolation and cultivation of anaerobic, microaerophilic, or capnophilic bacteria by use of gas generating sachets inside single-use resealable pouches. The GasPak EZ Gas Generating Sachet consists of a reagent sachet containing inorganic carbonate, activated carbon, ascorbic (citric) acid and water. When the sachet is removed from the outer wrapper, the sachet becomes activated by exposure to air. The activated reagent sachet and specimens are placed in the GasPak EZ Incubation Container and the container is sealed. The sachet rapidly reduces the oxygen concentration within the container. At the same time, inorganic carbonate produces carbon dioxide.

Anaerobic environment-action: The gas generator envelope is activated by the addition of water; Hydrogen generated from a sodium borohydride tablet combines with the oxygen in the jar in the presence of the palladium catalyst to form water, removing the oxygen.

Anaerobic conditions are achieved rapidly, generally within 1 hour of incubation; the carbon dioxide concentration is approximately 4-10%. At 35 °C, the Gas Pak methylene blue anaerobic indicator becomes decolorized at 4-6 hours.

Описание: Gas_pack_system

 

Описание: jar

Gas Pak with  indicator strip and  CO2 generator pack

 

Biological methods. 1. Fortner’s method. A method includes general cultivation outrient medium an aerobic and an anaerobic microorganisms. At first part of nutrient medium in Petri plate aerobic bacteria  (Serratia marcescens) are inoculated, at second – tested material with anaerobic bacteria. The edges of cup are closed hermetically (e.g. with paraffin). In a few days the colonies both aerobic and anaerobic microbes grow. Serratia marcescens forms pink or colourless colonies, and when there are violations of hermetic conditions – bright red ones. The colonies of anaerobic microbes grow on other half of Petri plate.

2. Hennel’s technique (“watch glasses technique”). There is original modification of previous one. Tested material with anaerobic bacteria is inoculated on the square 2-2,5 cm in diameter. Later it is covered by special convex glass where is nutrient medium and Serratia marcescens on it. Aerobic microbes (Serratia spp.) taking an oxygen create favourable conditions for anaerobes growth.

Now the stationary anaerobic boxes for cultivation of anaerobic bacteria are made.

Описание: anaer_box

 

One of the main requirements in cultivating anaerobic bacteria is removal of oxygen from the nutrient medium. The content of oxygen can be reduced by a great variety of methods: immersing of the sur­face of the nutrient medium with petrolatum, introduction of micro­organisms deep into a solid nutrient medium, the use of special anaerobic jars.

 

First day. Inoculate the studied material into Kitt-Tarozzi medi­um (nutrient medium): concentrated meat-peptone broth or Hottinger’s broth, glucose, 0.15 per cent agar (pHl 7.2-7.4).

To adsorb oxygen, place pieces of boiled liver or minced meat to form a 1-1.5 cm layer and pieces of cotton wool on the bottom of the test tube and pour in 6-7 mi of the medium. Prior to inoculation place the medium into boiling water for 10-20 min in order to remove air oxygen contained in it and then let it cool. Upon isolation of spore forms of anaerobes the inoculated culture is reheated at 80 ‘”C for 20-30 min to kill non-spore-forming bacteria. The cultures are immersed with petrolatum and placed into an incubator. Apart from Kitt-Tarozzi medium, liquid media containing 0.5-1 per cent glucose and pieces of animal organs, casein-acid and casein-mycotic hydrolysates can also be employed.

Casein-acid medium’, casein-acid hydrolysate, 0.5 1; 10 per cent yeast extract, 0.35 1: 20 per cent corn extract, 0.15 1; millet, 240 g; cotton wool, 25 g. The me­dium is poured into flasks with millet and cotton wool and sterilized for 30 min at 110 0C. Use casein-mycotic hydrolysate to obtain casein-mycotic me­dium.

Second day. Take note of changes in the enrichment medium, namely, the appearance of opacification or opacification in combination with gas formation. Take broth culture with a’ Pasteur pipette and transfer it through a layer of petrolatum onto the bottom of the test tube. Prepare smears on a glass slide in the usual manner, then flame fix and Gram-stain them.During microscopic examination record the presence of Gram-positive rod forms (with or without spores). Streak the culture from the enrichment medium onto solid nutrient media. Isolated colonies are prepared by two methods.

1. Prepare three plates with blood-sugar agar. To do it, melt and cool to 45 °C 100 ml of 2 per cent agnr on llottinger’s broth, then add 10-15 ml of deftbrinated sheep or rabbit blood and 10 ml of 20 per cent sterile glucose. Take a drop of the medium witli microorgan­isms into the first plate and spread it along the surface, using a glass spatula. Use the same spatula to streak tlic culture onto tlie second and then third plates and place them into an anaerobic jar or other similar devices at 37 ”C for 24-48 hrs (Zoisslcr’s method).

2, Anaerobic microorganisms are grown deep in a solid nutrient medium (Veinherg’s method of sequential dilutions). The culture from the medium is taken with a Pasteur pipette with a soldcd tip and transferred consecutively into the 1st, 2nd, and 3rd test tubes with 10 ml of isotonic sodium chloride solution. Continue to dilute^ transferring the material into the 4th, 5th. and 6th thin-walled test tubes (0.8 cm in diameter and 18 cm in height) with melted and cooled to 50 °C meat-peptone agar or Wilson-Blair medium (to 100 ml of melted meat-peptone agar with 1 per cent glucose add 10 ml of 20 per cent sodium sulphite solution and 1 ml of 8 per cent ferric chloride). Alter agar has solidified, place the inoculated culture into an incubator.

On the third day, study the isolated colonies formed in tlie plates and make smears from the most typical ones. The remainder is in­oculated into Kitt-Tarozzi medium. The colonies in the test tubes are removed by means of a sterile Pasteur pipette or the agar column may be pushed out of the tube by steam generated upon warming the bottom of the test tube. Some portion of the colony is used to prepare smears, while its remainder is inoculated into Kitt-Tarozzi medium to enrich pure culture to be later identified by its morpholo­gical, cultural, biochemical, toxicogenic, antigenic, and other properties.

The Vinyale-Veyone’s method is used for mechanical protection from oxygen. The seeding are made into tube with melting and cooling (at 42 0C) agar media.

 

 

 

III. Thioglycollate Medium – which we utilize in our Bacteriology laboratory courses – is a “standard” medium for the determination of oxygen relationships, and it will support the growth of common, easily-grown chemoheterotrophic bacteria. The observed growth patterns of organisms in this medium determine their oxygen relationship designations (strict aerobe, facultative anaerobe, etc.) which correlate with such physiological abilities as respiration, fermentation and the catalase reaction and also whether there is an inhibitory effect on the organism in the presence of air. See the table under the photo below. Thus, a description of a chemoheterotrophic organism as a “strict aerobe” can imply a number of associated characteristics that may be unnecessary to specify separately (able to respire, unable to ferment, catalase-positive, azide-sensitive, etc.).

The amino acids and glucose in the medium can be respired, and glucose is the only fermentable energy source in the medium except for those exceptional organisms such as certain species of Clostridium which can ferment amino acids.

With Thioglycollate Medium, we are able to differentiate two distinct patterns of growth for those classified in the Bergey’s Manual definitions (above) as “facultative anaerobes”:

Those which are indifferent to oxygen and have a strictly fermentative type of metabolism grow evenly throughout the medium. We term such an organism an aerotolerant anaerobe and set that off as an additional category of oxygen relationship (added to the list of four above).

Those left in the facultative anaerobe category show greater concentration of growth at the top of the medium where oxygen is present and aerobic respiration is then possible. Comparing the degree of growth under aerobic vs. anaerobic conditions can be a good demonstration of the relative efficiencies of aerobic respiration and fermentation when it comes to generation of cell mass.

The terms “facultative” and “aerotolerant” are always meant to modify another term such as “anaerobe” and they should not be used by themselves. Describing an organism as simply “facultative” may mean “facultative anaerobe,” “facultative phototroph,” or a variety of other things.

One must consider the following limitations of Thioglycollate Medium:

Many organisms (including a lot of chemoheterotrophs) cannot grow in this medium for one reason or another.

No allowance is given in the medium or method for anaerobic growth (1) with alternate electron acceptors (such as nitrate) or (2) in light (such as what is seen with the anoxygenic photosynthetic bacteria). Thus, an organism which may be termed a “strict anaerobe” in the more general sense – i.e., one which cannot tolerate oxygen and can only obtain energy by reactions which do not involve O2 – would only show anaerobic growth in this test if it were capable of fermentation of the glucose in this medium.

The results in Thioglycollate Medium can be difficult to read. As shown in the table below, an organism’s oxygen relationship designation can be determined by a combination of other methods which can be used as a check to see if the medium is showing the correct results – i.e., (1) testing for fermentation in Glucose Fermentation Broth, (2) performing the catalase test, and (3) testing if the organism can grow in the presence of oxygen. These methods tend to be quite reliable and can be utilized if Thioglycollate Medium is not available or even specified for use in the identification process. With that in mind, Thioglycollate Medium could be considered redundant.

The results we see in Thioglycollate Medium are shown below. (Note that microaerophiles are not included.) The accompanying table gives related information.

 

Описание: thiomed2

 

Corresponding tube no. above

1

2

3

4

Oxygen relationship designation

STRICT

(OBLIGATE)

AEROBE

FACULTATIVE

ANAEROBE        

AEROTOLERANT

ANAEROBE

STRICT

(OBLIGATE)

ANAEROBE

 

Aerobic respiration*        

+

+

–

–

Fermentation*

–

+

+

+

Ability to grow aerobically

(oxygen tolerance)

+

+

+

–

Ability to grow anaerobically

–

+

+

+

Catalase reaction

+

+

–

–

Reaction in Glucose O/F Medium

(for those able to grow well in medium)

O or –

F

 

 

Response to sodium azide in a growth medium

 

SENSITIVE

SENSITIVE (under aerobic conditions)

RESISTANT

RESISTANT

 

*  These are the basic things tested for in this medium. Whether or not any organism can obtain energy by anaerobic respiration or phototrophy is not relevant to these designations of oxygen relationships.

 

So, in becoming a practicing bacteriologist, one will see that there is more to this concept than whether bacteria simply “like” or “don’t like” oxygen – which, unfortunately, is the extent to which oxygen relationships are too-often and unconscionably taught.

 

IV. Rather than (or in addition to) using “oxygen relationships” as descriptive terms – however they may be determined or defined – we can characterize and classify bacteria more consistently and comprehensively by applying the method(s) of energy generation of which an organism is capable:

aerobic respiration

anaerobic respiration

fermentation

anoxygenic phototrophy

oxygenic phototrophy

 

Remember that Thioglycollate Medium tests for an organism’s ability to perform aerobic respiration and/or fermentation – the results of which give us the “oxygen relationship” categories for those organisms which can grow in the medium under the incubation conditions provided. Anaerobic growth in this medium is only associated with fermentation.

 

V. The following summary may help to explain how media formulations can allow anaerobic growth for organisms capable of doing so for one reason or another. The same organism – a typical strain of E. coli – was inoculated into tubes 1, 2 and 3, and a “facultative phototroph” was inoculated into tube 4.

 

In Tube #1, we have a medium containing peptone and agar plus other nutrients a “typical organism” (i.e., a commonly-found, easy-to-grow chemo- or photoheterotroph) might require for metabolism and replication – except that nothing is included which would support anaerobic growth such as glucose (or something else that could be fermented) or nitrate (or some other electron acceptor/”oxygen substitute” that could be used in anaerobic respiration). After inoculation of this medium and incubation in the dark, any growth would be due to aerobic respiration with the growth only at the top of the medium. There would be no anaerobic growth except for some rare, exceptional organisms which can ferment amino acids.

Описание: xmed

 

Tube #2 is the same medium as in #1, but glucose has been added. After incubation (in the dark), any anaerobic growth would be due to fermentation of the glucose. Thus the medium can be used to detect whether or not an organism can respire (aerobically) or ferment. An example of such a medium is the Thioglycollate Medium we use to test common chemoheterotrophs for “oxygen relationships” (discussed above).

 

Tube #3 is the same medium as in #1, but potassium nitrate has been added. After incubation (in the dark), any anaerobic growth would be due to anaerobic respiration where the organism is using nitrate as the electron acceptor. In Bact. 102 (Exp. 7), we do a test in a broth medium for nitrate reduction; with reagents we can detect nitrite formation, and with the Durham tube we can detect N2 gas formation. One can probably see why we would not want to include nitrate in the Thioglycollate Medium above.

 

Tube #4 is the same medium as in #1, but we have incubated the tube in the presence of light. With light as the ultimate energy source, anaerobic growth would be due to anoxygenic phototrophy. This is the basis for the test we do in Bact. 102 (Exp. 11.1) to see if our isolates of purple non-sulfur bacteria are either “strict phototrophs” (just anaerobic growth in the light) or “facultative phototrophs” (anaerobic growth in the light, plus aerobic growth due to aerobic respiration whether in the dark or the light). Click here for a summary of this test.

 

 

As genotypic characterization (determination of the DNA and RNA characteristics of our bacteria) is becoming more widely practiced, we may soon be back to one standard of characterizing and identifying bacteria. This time it will be universally applicable as all bacterial genera and species become uniformly defined according to genotypic uniqueness. We hope that the results of the phenotypic tests we run will correlate with the genotypic characteristics and bring about accurate and useful identification of our organisms.

 

In the table below, a few commonly-found and easily-grown chemoheterotrophic genera are sorted out based on various “primary tests” which include the use of Both Glucose Fermentation Broth and Glucose O/F Medium include. The benzidine test which has been used effectively for the presence of iron-porphyrin compounds such as cytochromes and the true catalase enzyme. Some organisms possess the enzyme cytochrome a3 oxidase as part of the electron transport system in respiration; this enzyme is responsible for a positive reaction in the oxidase test where the dye tetramethyl-p-phenylenediamine is reduced to a purple compound.

Further tests (not indicated) would then be done to determine positively the genus identification and also the likely species. You can go where the experts are and consult the latest editions of Bergey’s Manual of Systematic Bacteriology and Bergey’s Manual of Determinative Bacteriology for more information. Bergey’s Manual of Systematic Bacteriology is a multi-volume set, and the first volume of the new, 2nd edition is out now but may not be specifically helpful for the organisms listed in the table below. Bergey’s Manual of Determinative Bacteriology is mainly used for identification, but the present 9th edition has become quite dated in that respect.

The idea for the format of the following table comes from the classic Cowan and Steel’s Manual for the Identification of Medical Bacteria, 2nd edition, revised by S. T. Cowan (1974, Cambridge University Press). This table of often-isolated chemoheterotrophic bacteria was put as a guide in targeting likely names of genera to pin on the “nature isolates.” An X marks the place where a certain pattern of characteristics matches up with a possible genus. Considering additional characteristics of the isolate, one can consult Bergey’s Manual or The Prokaryotes for this genus and related genera (oearby pages) for a more definitive identification.

Gram reaction
(young culture)

+

+

+

+

+

+

+

+

+

+

–

–

–

–

–

–

shape

coccus
(clusters)

coccus
(clusters)

coccus
(chains)

coccus
(tetrads)

rod

rod

irreg.
rod

rod

rod

rod

rod

rod

rod

rod

rod

coccus
(pairs)

aerobic growth

+

+

+

+

+

+

+

–

+

+

+

+

+

+

+

+

anaerobic growth

–

+

+

+

+

–

–

+

+

–

–

–

+

+

+

–

endospores

–

–

–

–

–

–

–

+

+

+

–

–

–

–

–

–

motility
(Motility Medium)

–

–

–

–

–

+

–

+
or –

+
or –

+
or –

+
or –

+
or –

–

+

+

–

catalase reaction

+

+

–

–

–

+

+

–

+

+

+

+

+

+

+

+

benzidine reaction

+

+

–

–

–

+

+

–

+

+

+

+

+

+

+

+

oxidase reaction

+

–

–

–

–

–

–

–

+
or –

+
or –

+

+

–

–

+

+

glucose fermentation to acid or to acid+gas

–

+

+

+

+

–

–

+ (or
–)

+

–

–

–

+

+

+

–

Glucose O/F Medium

 

 

 

 

 

 

 

 

 

 

–

O

F

F

F

O

Micrococcus

X

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

Staphylococcus

 

X

 

 

 

 

 

 

 

 

 

 

 

 

 

 

Streptococcus

 

 

X

 

 

 

 

 

 

 

 

 

 

 

 

 

Lactococcus

 

 

X

 

 

 

 

 

 

 

 

 

 

 

 

 

Enterococcus

 

 

X

 

 

 

 

 

 

 

 

 

 

 

 

 

Leuconostoc

 

 

X

 

 

 

 

 

 

 

 

 

 

 

 

 

Pediococcus

 

 

X

X

 

 

 

 

 

 

 

 

 

 

 

 

Aerococcus

 

 

 

X

 

 

 

 

 

 

 

 

 

 

 

 

Lactobacillus

 

 

 

 

X

 

 

 

 

 

 

 

 

 

 

 

Kurthia

 

 

 

 

 

X

 

 

 

 

 

 

 

 

 

 

Arthrobacter

 

 

 

 

 

 

X

 

 

 

 

 

 

 

 

 

Clostridium

 

 

 

 

 

 

 

X

 

 

 

 

 

 

 

 

Bacillus

 

 

 

 

 

 

 

 

X

X

 

 

 

 

 

 

Alcaligenes

 

 

 

 

 

 

 

 

 

 

X

 

 

 

 

 

Pseudomonas

 

 

 

 

 

 

 

 

 

 

 

X

 

 

 

 

Klebsiella

 

 

 

 

 

 

 

 

 

 

 

 

X

 

 

 

Shigella

 

 

 

 

 

 

 

 

 

 

 

 

X

 

 

 

Salmonella

 

 

 

 

 

 

 

 

 

 

 

 

 

X

 

 

Escherichia

 

 

 

 

 

 

 

 

 

 

 

 

 

X

 

 

most other
enteric genera

 

 

 

 

 

 

 

 

 

 

 

 

 

X

 

 

Aeromonas

 

 

 

 

 

 

 

 

 

 

 

 

 

 

X

 

Chromobacterium

 

 

 

 

 

 

 

 

 

 

 

 

 

 

X

 

Neisseria

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

X

 

 

The identification of bacteria is a careful and systematic process that uses many different techniques to narrow down the types of bacteria that are present in an unknown bacterial culture, such as the infected blood of someone dangerously ill with meningitis.

 

Identification techniques include:

· Morphological (according to the bacterial morphology);

· Cultural (according to the bacterial growth signs in/on different nutrient media);

· Biochemical (according to the bacterial ability to utilize differen substrates);

· Serological (according to the bacterial antigens);

· Bilological (according to the bacterial ability to cause different changes in laboratory animals after their inoculation by microbes);

· Flow cytometry;

· Phage typing;

· Protein analysis;

· Comparison of nucleotide sequenses.

 

Morphological identification (according to the bacterial morphology) – Microscopic morphology

 

A number of morphological characteristics are useful in bacterial identification.  These include the presence or absence of:

·                                                 cell shape

Описание: image022Описание: image032

                                                                                       Cocci                                                      Rods

·                                                 cell size

·                                                 endospores

Описание: image030

Spores

·                                                 flagella

Описание: image037

Flagella

·                                                 glycocalyx

·                                                 etc.

The techniques used at the earliest stages are relatively simple. An unknown sample may contain different bacteria, so a culture is made to grow individual bacterial colonies. Bacteria taken from each type of colony is then used to make a thin smear on a glass slide and this is examined using a light microscope. Viewing the bacteria shows if they are cocci or bacilli or one of the rarer forms, such as the corkscrew shaped spirochaetes.

 

Gram Staining

Cocci and bacilli can be either gram positive bacteria or gram negative bacteria, depending on the structure of their cell wall. The Gram Stain is named after Hans Christian Gram, a bacteriologist from Denmark who developed the technique in the 1880s. The test is performed on a thin smear of an individual bacterial colony that has been spread onto a glass slide. Gram positive bacteria retain an initial stain, crystal violet, even when the bacterial smear is rinsed with a mixture of acetone and ethanol. The solvent removes the dark blue colour from gram negative bacteria, dissolving away some of the thin cell wall. When a second stain, a pink dye called fuchsin is then added, gram positive bacteria are unaffected by this, as they are already stained dark blue, but the gram negative bacteria turn bright pink. The colour difference can be seen easily using a light microscope.

 

Описание: Gram_positiveОписание: gram_negat_fusobact

Gram-positive (left) and gram-negative (right) microbes

 

Acid Fast Bacteria

Spirochaetes such as the Mycobacteria that cause tuberculosis and leprosy do not stain well using the Gram Stain. Other stains that do not wash away with dilute acid are used instead. The bacteria are deeply stained, either bright red against a blue background or red against a green background. Because the stain cannot be removed by washing with acid, organisms stained by these methods are termed acid-fast bacteria.

 

Описание: image025

This stains acid-alcohol fast bacteria, e.g. mycobacteria.

 

 

Описание: image060

Bacterial spores are seen as red structures: vegetative cells stain blue.

 

Описание: spore

Bacterial spores (Schaeffer-Fulton stain technique)

 

Motility

 

·  Place a drop of liquid culture on a microscope coverslip.

·  Invert over a plasticine ring on a microscope slide.

·  Examine under x40 objective (high power dry lens).

·  Accidental spills may occur during this procedure.

 

 

Описание: image061

Wet mount technique

 

Описание: image062

 

Описание: motility

Left – negative test, right – positive

 

Capsule staining (relief staining with eosin)

 

·  Place a drop of broth culture on one end of a microscope slide.

·  Add one drop of eosin solution and leave for one minute.

·  Take a second slide and draw its edge back to contact the stained suspension.

·  Holding the second slide at 45 degrees, spread a thin layer of fluid along the first slide by a continuous forward movement.

Allow the film to air dry then examine under oil-immersion. 

 

Описание: capsule

Background material and cells stain red. Capsular material appears as an unstained halo around the cells

 

Aerobic or Anaerobic?

Finding out whether bacteria are aerobic or anaerobic helps separate them into different categories. It is relatively easy to discover whether a bacterial culture grows in the presence or absence of oxygen. Bacteria that only grow if oxygen is available are called aerobic bacteria. Anaerobic bacteria can grow without oxygen, and some species are killed by oxygen, only surviving in completely oxygen-free environments. These species are described as obligate anaerobes (see above)

 

Cultural (according to the bacterial growth signs in/on different nutrient media) – colony morphology

Описание: image031

Описание: Bacterial_colony_morphology

Описание: mixed_colony

Mixed colonies

 

Biochemical (according to the bacterial ability to utilize differen substrates) – Enzyme Tests

Within broad types of bacteria, individual species have different metabolic systems and are able to grow using a range of nutrients. Testing bacteria to find out whether they are positive or negative for specific enzymes helps narrow down their identity. For example, Staphylococcus aureus tests positive for the enzyme coagulase, but Staphylococcus epidermidis is negative for this enzyme.

Fermentative properties of microbes are used in the  laboratory diagnosis of infectious diseases, and in studying microbes of the soil, water, and air.

Описание: image039

To identify the isolated pure culture, supplement the study of morphological, tinctorial, and cultural features with determination of their enzymatic and antigenic attributes, phago- and bacterio-cinosensitivity, toxigenicity, and other properties characterizing their species specificity.

To demonstrate carbohydrate-splitting enzymes, Hiss’ media are utilized. When bacteria ferment carbohydrates with acid formation, the colour of the medium changes due to the indicator present in it. Depending on the kind and species of bacteria studied, select media with respective mono- and disaccharides (glucose, lactose, maltose, sucrose), polysaccharides (starch, glycogen, inulin), higher alcohols (glycerol, mannitol). In the process of fermentation of the above sub­stances aldehydes, acids, and gaseous products (CO2, H2, etc.) are formed.

Описание: carb%20ferm

 

 

 

TSI (Triple Sugar Iron) and KIA (Kligler’s Iron Agar)

Triple Sugar Iron Agar (TSI) and Kligler’s Iron Agar (KIA) are used to determine if bacteria can ferment glucose and/or lactose and if they can produce hydrogen sulfide or other gases. (If an organism can ferment glucose, it is “glucose positive”. If it ferments lactose, it is “lactose positive”.) In addition, TSI detects the ability to ferment sucrose. These characteristics help distinguish various Enterobacteriacae, including Salmonella and Shigella, which are intestinal pathogens.

TSI contains three sugars: glucose, lactose and sucrose. Lactose and sucrose occur in 10 times the concentration of glucose (1.0% versus 0.1%). Ferrous sulfate, phenol red (a pH indicator that is yellow below pH 6.8 and red above it), and nutrient agar are also present. The tube is inoculated by stabbing into the agar butt (bottom of the tube) with an inoculating wire and then streaking the slant in a wavy pattern. Results are read at 18 to 24 hours of incubation.

Reading the Results

A yellow slant on TSI indicates the organism ferments sucrose and/or lactose. On KIA a yellow slant indicates the organism ferments lactose. (Because KIA does not contain sucrose, sucrose fermentation is not detected with KIA tests.) Other results are the same for TSI and KIA. A yellow butt shows that the organism fermented glucose. Black preciptate in the butt indicates hydrogen sulfide production.  Production of gases other than hydrogen sufide is indicated either by cracks or bubbles in the media or the media being pushed away from the bottom of the tube.    

Understanding the Results 

If an organism ferments glucose only, the entire tube turns yellow due to the effect of the acid produced on phenol red. Because there is a minimal amount of glucose present in the tube, the organism quickly exhausts it and begins oxidizing amino acids for energy. Ammonia is thus produced and the pH rises. Within 24 hours the phenol red indicator reverts to its original red color on the slant. Because TSI/KIA media is poured as a deep slant, the butt has limited oxygen and bacteria are unable to oxidize amino acids there. The butt thus remains yellow.

If an organism can ferment lactose and/or sucrose, the butt and slant will turn yellow (as they do from glucose fermentation). However, they remain yellow for at least 48 hours because of the high level of acid products produced from the abundant sugar(s).  

KIA resembles TSI in all respects except that KIA contains two sugars (lactose and glucose) while TSI contain three sugars (lactose, glucose and sucrose). Like TSI media, KIA contains 10 times as much lactose as glucose. Thus KIA tests for an organism’s ability to ferment glucose or lactose but not sucrose. 

If the gas being produced is hydrogen sulfide (H2S), it reacts with the ferrous sulfate and preciptates out as a black precipitate (ferric sulfide) in the butt. Organisms producing large amounts of hydrogen sulfide (e.g. Salmonella and Proteus) may produce so much black precipitate that it masks the yellow (acid) color of the butt.

 

Описание: kia_1

1. Reading results

 

Описание: KIA2

2. Interpreting results on TSI

 

Описание: kia3

3. Interpreting results on KIA

 

To demonstrate proteolytic enzymes in bacteria, transfer the lat­ter to a gelatin column. Allow the inoculated culture to stand at room temperature (20-22 °C) for several days, recording not only the development of liquefaction per se but its character as well (lami­nar, in the form of a nail or a fir-tree, etc.).

Описание: gelatin1Описание: gelatin%20negative

Serratia marcescens on the left is positive for gelatinase production, as evidenced by the liquidation of the media. 

Salmonella typhimurium on the right is negative, as evidenced by the solidity of the media.

 

Proteolytic action of enzymes of microorganisms can also be ob­served following their streaking onto coagulated serum, with depres­sions forming around colonies (liquefaction). A casein clot is split in milk to form peptone, which is manifested by the fact that milk turns yellowish (milk peptonization).

More profound splitting of protein is evidenced by the formation of indol, ammonia, hydrogen sulphide, and other compounds. To detect the gaseous substances, inoculate microorganisms into a meat-peptone broth or in a 1 per cent peptone water. Leave the inocula­ted cultures in an incubator for 24-72 hrs.

To demonstrate indol by Morel’s method, soak narrow strips of filter paper with hot saturated solution of oxalic acid (indicator pa­per) and let them dry. Place the indicator paper between the test tube wall and stopper so that it does not touch the streaked medium. When indol is released by the 2nd-3rd day, the lower part of the pa­per strip turns pink as a result of its interaction with oxalic acid.

The telltale sign of the presence of ammonia is a change in the col­our of a pink litmus paper fastened between the tube wall and the stopper (it turns blue).

Hydrogen sulphide is detected by means of a filter paper strip saturated with lead acetate solution, which is fast­ened between the tube wall and the stopper. Upon interaction be­tween hydrogen sulphide and lead acetate the paper darkens as a re­sult of lead sulphide formation.

Описание: R_24_ciрководень

 

To determine catalase, pour 1-2 ml of a 1 per cent hydrogen per­oxide solution over the surface of a 24-hour culture of an agar slant. The appearance of gas bubbles is considered as a positive reaction. Use a culture known to contain catalase as a control.

The reduction ability of microorganisms is studied using methylene blue, thionine, litmus, indigo carmine, neutral red, etc. Add one of the above dyes to nutrient broth or agar. The medium decolourizes if the microorganism has a reduction ability. The most widely em­ployed is Rothberger’s medium (meat-peptone agar containing 1 per cent of glucose and several drops of a saturated solution of neutral red). If the reaction is positive, a red colour of the agar changes into yellow, yellow-green, and fluorescent, while glucose fermentation is characterized by cracks in the medium.

 

Bile solubility test (Pure culture)

 

·  Emulsify a few colonies of the test culture in 1ml of saline to form a smooth suspension.

·  Add one drop of 10% sodium deoxycholate solution.

·  Incubate at 37oC.

·  Examine for clearing at 15 minutes, 30 minutes and 60 minutes.

Clearing should occur within 30 minutes

In a mixed culture place one drop of 10% sodium deoxycholate solution onto the test colony..

 

Описание: bile

This should lyse within 30 minutes. This method is not entirely reliable, and it is better to purify any suspected colony

 

Catalase Test

 

·  Using a glass capillary tube, pick a small amount of culture from the plate.

·  If possible do not pick from a blood containing medium as the presence of catalase in the medium itself may give a false positive result. This sometimes cannot be avoided.

·  Carefully invert the tube and insert it into the hydrogen peroxide solution.

·  Tilt the tube so the fluid flows onto the culture material.

·  Look for the immediate formation of oxygen bubbles in the tube indicating the activity of catalase.

 

Описание: catalase3

Описание: Catalase_positiveОписание: catalase_negative

 

Catalase test positive (left) and negative (right)

 

Описание: catalase4

 

Catalase test

 

Coagulase Test

 

A. Slide method:

This test detects the presence of “clumping factor” and is not a true coagulase test.

·  Place three separate drops of saline on a clean slide.

·  Suspend a loopful of test colony in two of these, and a loopful of control Staphylococcus aureus in the third.

·  With a sterile loop, add a drop of citrated rabbit plasma to one test and the control suspension.

·  Clumping occurring within 10 seconds indicates a positive result.

·  The saline control should remain evenly suspended.

B. Tube method:

·  Emulsify a few colonies of control Staphylococcus aureus and the test isolate into appropriately labelled tubes containing a 1/10 dilution of plasma in 0.85% saline.

·  Incubate at 37oC.

·  Examine for coagulation at 1, 3 and 6 hours.

 

 

Описание: plasmocoagulase

Conversion of the plasma into a soft or stiff gel, seen on tilting the tube to a horizontal position indicates a positive result.

 

DNase Test

 

·  Inoculate sections of tryptose agar medium containing DNA with material from test colonies.

·  Controls of known Staphylococcus aureus and Staphylococcus epidermidis should be inoculated as positive and negative controls.

·  Incubate the plate at 37oC for 18-24 hours.

·  Flood the plate with lM HCl that precipitates DNA and turns the medium cloudy.

 

 

Описание: DNAse

The presence of a zone of clearing round the area of growth indicates DNase production that has hydrolysed the DNA.

 

Lecithinase activity results in the production of an opaque zone of precipitation around the area of growth. This precipitation should not be present on that side of the plate previously inoculated with specific α-antitoxin.

Nagler Test

 

Clostridium perfringens elaborates a variety of exotoxins, one of which is α-toxin (lecithinase or phospholipase C). The following test is used to demonstrate production of this specific toxin.

·  Divide an egg yolk plate into two equal sections.

·  Spread a loopful of Clostridium perfringens antitoxin over half the plate and allow to dry.

·  With a single streak, inoculate the plate with a loopful of the test culture, beginning on the untreated side of the plate.

·  Incubate at 37oC under anaerobic conditions.

 

 

Описание: lecitinase1

 

Описание: lecitinase

Lecithinase activity results in the production of an opaque zone of precipitation around the area of growth. This precipitation should not be present on that side of the plate previously inoculated with specific α-antitoxin

Optochin Test

 

·  Divide a blood agar plate into three equal sections.

·  Inoculate one with a known Streptococcus pneumoniae, another with a viridans streptococcus and the third with the test isolate.

·  Care must be taken to keep the cultures separate.

·  Place a 5 microgram Optochin disc (ethylene hydrocupreine hydrochloride) in the centre of the plate.

·  Incubate at 37oC overnight and observe the zone of inhibition.

 

Описание: optochin

 

Oxidase Test

 

·  Dip a sterile swab in freshly prepared oxidase reagent (1% tetra methyl-para-phenylene diamine dihydrochloride) then touch the target colony. A positive reaction is indicated by the rapid appearance of a purple colour on the swab where the test bacteria adhere.

Описание: oxydase_test1

 

Alternatively

·  Place a drop of freshly prepared oxidase reagent (1% tetra methyl-para-phenylene diamine dihydrochloride) on a piece of filter paper in a Petri dish or on a glass slide.

·  Leave for 1 minute.

·  Using a wooden stick or a glass slide (not a wire loop) rub a small amount of the test colony onto the moistened paper.

·  Again, a positive test is indicated by the rapid appearance of a purple colour at this site.

 

Описание: oxidase%20test

 

 

Indole production – measure the ability to hydrolyse and deaminate tryptophan

– Klesiella-enterobacter-salmonella-serratia are mostly negative

– positive-red colour

Описание: indole1

 

Methyl red  – methyl red, a pH indicator with a range between 4.4(red) and 6.0(yellow)

– only species that produce suffiicient acids can maintian the pH at below4.4 against the buffer system of the test medium

– most species of Enterobacteriaceae produce strong acids. Enterobacter-serratia do not produce enough acids

 

Описание: metil_red2

Описание: Methyl%20red

Positive-stable red colour in the surface layer of the medium

 

Voges-proskauer reaction test

-this test is based on the conversion of acetoin to a red coloured complex through the action of KOH, atmospheric 02 and alpha napthol

–Klesiella-enterobacter-serratia is able to perform this pathway

–

 

Описание: Vp
Voges-proskauer reaction test. Red colour at the surface of the medium after 15 mins following the addition of reagents

 

 

Citrate utilisation test – some bacteria have the ability to utilize citrate as the sole carbon sourc and turn the medium allkaline due to production of ammonia

–Escherichia-Edwardisella-shigella-salmonella cannot utilise citrate as the sole source of carbon

 

 

Описание: citrate

Описание: Citrates

Positive – from colour green to blue

 

Urease test – some species posses the enzyme urease and able to hydrolyze urea with the release of ammonia and carbon dioxide

– this is used mainly to differentiate urease positive Proteus species from other member of Enterobacteriaceae

– positive-yellowish orange to pink

 

Описание: urea1

Описание: Urease_Test
Positive – yellowish orange to pink



The API-20E test kit for the identification of enteric bacteria (bioMerieux, Inc., Hazelwood, MO) provides an easy way to inoculate and read tests relevant to members of the Family Enterobacteriaceae and associated organisms. A plastic strip holding twenty mini-test tubes is inoculated with a saline suspension of a pure culture (as per manufacturer’s directions). This process also rehydrates the dessicated medium in each tube. A few tubes are completely filled (CIT, VP and GEL as seen in the photos below), and some tubes are overlaid with mineral oil such that anaerobic reactions can be carried out (ADH, LDC, ODC, H2S, URE).

After incubation in a humidity chamber for 18-24 hours at 37°C, the color reactions are read (some with the aid of added reagents), and the reactions (plus the oxidase reaction done separately) are converted to a seven-digit code. The code is fed into the manufacturer’s database via touch-tone telephone, and the computer voice gives back the identification, usually as genus and species. The reliability of this system is very high, and one finds systems like these in heavy use in many food and clinical labs.

Note: Discussion and illustration of the API-20E system here does not necessarily constitute any commercial endorsement of this product. It is shown in our laboratory courses as a prime example of a convenient multi-purpose testing method one may encounter out there in the “real world.”

In the following photos:

·  Note especially the color reactions for amino acid decarboxylations (ADH through ODC) and carbohydrate fermentations (GLU through ARA).

o          The amino acids tested are (in order) arginine, lysine and ornithine. Decarboxylation is shown by an alkaline reaction (red color of the particular pH indicator used).

o          The carbohydrates tested are glucose, mannitol, inositol, sorbitol, rhamnose, sucrose, melibiose, amygdalin and arabinose. Fermentation is shown by an acid reaction (yellow color of indicator).

 

·  Hydrogen sulfide production (H2S) and gelatin hydrolysis (GEL) result in a black color throughout the tube.

·  A positive reaction for tryptophan deaminase (TDA) gives a deep brown color with the addition of ferric chloride; positive results for this test correlate with positive phenylalanine and lysine deaminase reactions which are characteristic of Proteus, Morganella and Providencia.

In the first set of reactions:

·  Culture “5B” (isolated from an early stage of sauerkraut fermentation) is identified as Enterobacter agglomerans which has been a convenient dumping ground for organisms now being reassigned to better-defined genera and species including the new genus Pantoea. This particular isolate produces reddish (lactose +), “pimply” colonies on MacConkey Agar which exude an extremely viscous slime as may be seen here; this appearance is certainly atypical of organisms identified as E. agglomerans or Pantoea in general.

·  Culture “8P44” is identified as Edwardsiella hoshinae. The CDC had identified this culture (in 1988) as the ultra-rare Biogroup 1 of Edwardsiella tarda which may not be in the API-20E database. This system probably would not be able to differentiate between these two organisms.

 

Описание: http://www.jlindquist.net/generalmicro/GBimages/API1.jpg

Описание: http://www.jlindquist.net/generalmicro/GBimages/API2.jpg

 

Serological identification (according to the bacterial antigens)

All immunological tests are based on specific antibody-antigen interaction. These tests are called serological since to make them one should use antibody-containing sera.

Serological tests are employed in the following cases: (a) to deter­mine an unknown antigen (bacterium, virus, toxin) with the help of a known antibody; (b) to identify an unknown antibody (in blood serum) with the help of a known antigen. Hence, one component (ingredient) in serological tests should always be a known entity.

The main serological tests include tests of agglutination, precipi­tation, lysis, neutralization, and their various modifications.

 

Agglutination Tests

Every individual species of bacterium has a unique collection of 3D shapes on its surface, called antigens. These are formed by the molecules on the outside of the cell wall. When a bacterium infects a human or an animal, the immune system reacts to these antigens, making a specific antibody to each one. Antiserum raised against a known bacterial species can therefore be used to positively identify if that species is present in an unknown culture. A small amount of different antiserum, specific for different bacteria, is used to test a sample. When the result is positive, the bacteria clump together, or agglutinate; when the result is negative, no clumping occurs.

 

Lancefield Grouping (Streptex Method)

 

·  Emulsify a loopful of the test culture in 0.4 ml of extraction enzyme.

·  Incubate at 37oC for 1 hour.

·  Add one drop of latex reagent to the appropriate circle of a black tile.

·  Next, add one drop of extract to each circle and mix, using a wooden stick.

·  Rock gently for one minute.

·  Clumping indicates a positive reaction.

 

Presumptive agglutination test. A presumptive AT is performed on glass slides. Using a Pasteur pipette, transfer several drops of se­rum of low (1:10-1:20) dilutions and a drop of isotonic saline for control on a grease-free glass slide. Into each drop of the serum as well as in the control drop, inoculate a loopful of 24-hour living culture of the microorganism picked from the surface of a solid nut­rient medium or pipette one drop of the suspension of dead microor­ganisms (diagnosticum). The inoculated culture is thoroughly mixed until the drop of liquid is uniformly turbid.

The reaction takes place at room temperature. Inspect visually the results in 5-10 min; occasionally one may use a 5 X magnifying lens for this purpose. If the glass slides are placed into a humid closed chamber to prevent evaporation, the results of the test may be read in 30-40 min as well.

A positive test is indicated by the appearance in the drop with serum of large or small flakes, readily visible upon rocking of the cover-slip. In a negative test, the fluid remains uniformly turbid.

Описание: Agglut

 

Slide agglutination

 

In cases where the number of microorganisms is small and the re­sults of the test are difficult to interpret, dry the drop of the inocu­lated serum, fix the preparation, stain it with Pfeifier’s fuchsine, and study under the microscope. In a positive test, a microscopic field is largely free of microorganisms but they are accumulated in some places. In a negative test, microorganisms are uniformly distributed throughout the microscopic field. This test is known as microagglutination.

 

Bilological identification

Biological examination. Biological study consists of infecting animals for the purpose of isolating the culture of the causative agents and their subsequent examination for pathogenicity and virulence.

Choice of experimental animals depends on the aim of the study. Most frequently used are rabbits, guinea pigs, albino mice, and albino rats. This is explained by the fact that they are susceptible to the causative agents of various infections diseases in man, easy to handle, and propagate readily. Hamsters, polecats, cotton rats, monkeys, birds, etc. may also be occasionally infected.

Specialized, particularly virological, laboratories, make use of genetically standardized, so-called inbred animals (mice, rabbits, guinea pigs, and others).

Working with experimental animals, one should keep it in mind that they may have spontaneous bacterial and viral diseases and latent infections activated as a result of additional artificial in­oculation. This hinders the isolation of pure culture of the causative agent and determination of its aetiological role. Gnotobiotes (without microflora) and animals free of pathogenic microorganisms have no such drawback. Currently they include chickens, rats, mice, guinea pigs, pigs, etc.

Laboratory animals are distinguished by their species, age, and individual sensitivity toward microorganisms. Thus, in selecting animals for study it is necessary to take into account their species and age. For instance, sensitivity in mongrel animals may show con­siderable individual variations. The use of inbred animals with a definite constant susceptibility toward microorganisms excludes individual variations in sensitivity and allows for reproducible re­sults.

Animals are infected for .isolating pure culture of the causative agent in cases where it is impossible to obtain it by any other method (for example, in contamination of the studied objects by extra­neous microflora which inhibits growth of the causative agent and in case of insignificant amounts of microorganisms or their trans­formation into filtering forms). Thus, in studying decayed corpses of rodents for the presence of plague causative agents, one inoculates (with suspension of the organs or blood) guinea pigs which die 3-7 days later with manifestations of septicaemia. Pure culture of the causative agent is readily isolated from the blood of internal organs.

Contamination of susceptible animals for reproducing the infec­tious process is used in diseases caused by Rickettsia and viruses.

Injection to mice of material from a patient with tickborne enceph­alitis brings about paralysis and death in these animals. To de­termine pathogenicity and virulence of the causative agents of plague, tularaemia, botulism, anthrax, and some viral diseases, cultures obtained from patients arc inoculated into albino mice, guinea pigs. rats, or suckling mice.

Описание: image199

Mouse with tetanus signs

 

Описание: image201

Guinea pig with botulism signs

 

Phage Typing. Bacteriophage (or phage ) are viruses that infect bacteria. Phage can be very specific in what bacteria they infect and the pattern of infection by many phage may be employed in phage typing to distinguish bacterial species and strains. The molecules on the surface of the bacterial cell are also targets for bacteriophages (phages for short). These are viruses that infect bacteria and that associate with different bacterial species very specifically. It is therefore possible to identify bacteria by investigating which bacteriophages can bind to their surface.

Описание: image045

 

Protein analysis [gel electrophoresis, SDS-PAGE, establishment of clonality]

I. The size and other differences between proteins among different organisms may be determined very easily employing methods of protein separation using methods collectively known as gel electrophoresis.

II.                                                        SDS-PAGE:

· One popular technique goes by the name SDS-PAGE which stands for sodium dodecyl sulfate-polyacrylamide gel electrophoresis

· Note that another name for SDS is sodium lauryl sulfate, a detergent you will find in many shampoos.

Such methods are very good at detecting small differences between isolates and are especially good at establishing clonality.

 

Protein and DNA Sequencing

In the last 25 years, molecular biology has developed rapidly and it is now possible to sequence the proteins from different bacterial species, make large databases of the sequences, and use them as very powerful identification tools. Similar database have been developed for bacterial DNA and bacterial RNA, particularly the RNA that forms the structural components of bacterial ribosomes.

Such techniques are also being used to follow the development of strains of bacterial species that are currently evolving at a very rapid rate. Strains of Chlamydia trachomatis, for example, are known to be exchanging large numbers of genes, forming completely new strains in a very short time. This is worrying – this bacterium is responsible for taking the sight of 8 million people living in developing countries today. Identifying the new strains and studying how they have arisen so quickly is crucial to controlling infection and preventing new cases of blindness.

There are a few basic things regarding 16S ribosomal RNA gene analysis. The actual mechanics of the various parts of this test can be found elsewhere on the web or in an up-to-date textbook, and they may be summarized here in the future. With this comparative test, differences in the DNA base sequences between different organisms can be determined quantitatively, such that a phylogenetic tree can be constructed to illustrate probable evolutionary relatedness between the organisms.

The nucleotide base sequence of the gene which codes for 16S ribosomal RNA is becoming an important standard for the definition of bacterial species. Comparisons of the sequence between different species suggest the degree to which they are related to each other; a relatively greater or lesser difference between two species suggests a relatively earlier or later time in which they shared a common ancestor.

A comparison between eleven species of gram-negative bacteria is illustrated on a separate sequence comparison page, where the sequences are aligned such that similarities and differences can be readily seen when one scrolls to the right or left. Gaps and insertions of nucleic acid bases (the result of “frame-shift” mutations occuring over eons of time as the organisms diverge from common ancestors) which affect long stretches of DNA have to be taken into account for a proper alignment.

In an earlier version of the above-mentioned sequence comparison page, when only four species were compared with each other, a relatively short segment stood out as appearing to be “frame-shifted” when comparing Pseudomonas fluorescens with a group of three enterics. This situation is shown as follows with the nucleotide bases of the segment in question shown in red.

Pseudomonas fluorescens

…gctaataccgcatacgtcctacgggagaaagcagggg…

Our new organism, shown below as “AH”

…gctaataccgcataacgtcgcaagaccaaagcggggg…

Budvicia aquatica

…gctaataccgcgtaacgtcgaaagaccaaagcggggg…

Edwardsiella tarda

…gctaataccgcataacgtcgcaagaccaaagtggggg…

One can surmise that a frame-shift mutation – if the bases are not misplaced to the extent that the mutation becomes silent or lethal – could be a “cheap” way to effect a major change in the genotype and subsequent phenotype – perhaps resulting in one of those infamous “leaps” in evolution one hears conjectured about from time to time. Even though the specific sequence within a shifted segment of DNA may not be changed, the shift will result in the nucleotide bases being re-grouped into different triplet codes and read accordingly, and the resulting gene may produce a vastly different protein which can change the appearance or function of a cell to a significant extent. So, when sequences between two species are compared, the organisms may appear to be a bit more closely related if these relatively short frame-shifted segments were taken into consideration. (With long stretches of DNA, one would not expect independant genes farther along the chromosome to be affected.)

When a 1308-base stretch of that part of the chromosome which codes for 16S ribosomal RNA was lined up and analyzed (“manually” when I had a little time to kill) to find the extent to which the above four organisms differed from each other, the percent difference between any two organisms was determined, and the results are summarized as follows:

 PF 

 PF 

 

 AH 

 14.8*

 AH 

 

 BA 

14.5

3.2

 BA 

 

 ET 

14.9

4.3

5.0

 ET 

* An example: The same bases appear in the same sequence, position by position, for each of the two organisms except for 14.8% of the time.

With the percent differences used to denote probable evolutionary distances between the organisms, a phylogenetic tree was roughed out to illustrate the relationships. The distances between any two organisms, when read along the horizontal lines, corresponds closely to the percent differences. (The bar at the bottom signifies approximately 1% base difference.)

Описание: http://www.jlindquist.net/generalmicro/GBimages/tree4.jpg

Databases of various gene sequences are found on the web. Genbank’s database was used as the source of the above sequences. And rather than having to line up the sequences and determine the differences manually, a set of programs to analyze sequence data and plot trees are available.

Methods of examination of bacterial susceptibility to antibiotics.  The main principles of rational antibiotic therapy of diseases.

 

Various chemical substances comparatively harmless for the macroorganism but with a lethal action on pathogenic micro-organisms are widely used in medical practice for treating patients with infectious diseases and in some cases for prophylaxis.

This method was known long ago to ancient people, and was used for treating certain diseases. The Peruvian Indians discovered the therapeutic action of cinchona bark, and in the 18th century cinchona bark was brought to Europe. The inhabitants of Brazil successfully employed the root of the ipecacuanha for treating amoebiasis. Mercury has been extensively employed in the therapy of syphilis. In the middle of the 16th century this method became known to the people of Europe.

The basis of modem chemotherapy was founded by P. Ehrlich and D. Romanowsky, who formulated the main scientific principles and the essence of chemotherapy. They showed that in the treatment of each infection a substance should be found which, during injection into the diseased body, will bring the least harm to it and cause the most destructive action to the pathogenic (causative) agent. P. Ehrlich devised the principles of synthesis of medicinal substances by chemical variations: methylene blue, derivatives of arsenic–salvarsan (‘”606″), neosalvarsan (“914”). By the further development of chemistry new medicinal preparations could be obtained.

Extensive experimental and clinical tests of chemopreparations were carried out by E  Metchnikoff.

Chemopreparations should have a specific action, a maximal therapeutic effectiveness, and a minimal toxicity for the body.

As a characteristic of the quality of a medicinal preparation, P. Ehrlich introduced the chemotherapeutic index which is the ratio of the maximal tolerated dose to the minimal curative dose:

 

maximal tolerated dose (DT—Dosis tolerata)

                —————————————————————-         > 3

minimal curative dose (DC—Dosis curativa)

 

The chemotherapeutic index should not be less than 3 Chemotherapeutic preparations include a number of compounds used in medicine

Arsenic preparations (novarsenol, myarsenol, aminarsone, osarsol, etc.) are administered in syphilis, relapsing fever, trypanosomiasis, amoebiasis, balantidiasis, anthrax, sodoku, and other diseases.

Bismuth preparations (basic bismuth nitrate, xeroform, basic bismuth salicylate, bioquinol, bismoverol, bithiurol, pentabismol, etc.) are used against enterocolitis and syphilis

Antimony compounds (tartaric antimony potassium salt, stibenil, stibozan, surmine, solusurmine, etc.) are used for treating patients with leishmaniasis and venereal lymphogranulomatosis.

Mercury preparations (mercury salicylate, mercuric iodide, mercury cyanide, calomel, unguentum hydrargyri cinereum containing metallic mercury, etc.) are prescribed for treating patients with syphilis and are used as antiseptics in pyogenic diseases.

Acridine preparations (rivanol, tripaflavine, acriflavine, acricide, flavicide, etc.) are recommended for pyogenic diseases and inflammatory processes of the pharynx and nasopharynx

Antimalarial substances include more than 30 preparations, e g , chinine hydrochloride, quinine sulphate, mepacrine (acrichine), rodochin (plasmocide), proguanyl (bigumal), pyrimethamine (chloridine), resochine, quinocide sulphones and sulphonamides, sulphadiamine, etc.

Alkaloid preparations (emetine, etc.) are used for treating patients with amoebiasis.

Sulphonamide preparations. The introduction into practice of compounds of the sulphonamide group (streptocid, ethasole, norsulphazol, sulphazine, methylsulphazine, sulphadimezin, urosulphan, phthalazole, sulgine, sulphacyi, soluble sulphacyl, disulphormin, etc.) marked a revolution in the chemotherapy of bacterial infections.

Sulphonamide preparations are used for treating pyogenic diseases, tonsillitis, scarlet fever, erysipelas, pneumonia, dysentery, anaerobic infections, gonorrhoea, cystitis, venereal  lymphogranulomatosis, psittacosis, ornithosis, trachoma, blennorrhoea in the newborn, etc.

There are several points of view concerning the mechanism of action of sulphonamides on microbes.

 

Antibiotics (Fr. anti against, bios life) are chemical substances excreted by some micro-organisms which inhibit the growth and development of other microbes (in recent years several antibiotics have been obtained semisynthetically).

 

 

 

Описание: Scheme_3

 

 

Antibiotics are obtained by special methods employed m the medical industry For the production of antibiotics strains of fungi, actmomycetes, and bacteria are used, which are seeded in a nutrient substrate After a definite growth period the antibiotic is extracted, purified and concentrated, checked for inocuousness and potency of action In composition a number of antibiotics (penicillin, streptomycin, gramicidin, etc ) have optically distorted molecules The antibacterial properties of some antibiotics are associated with optical inversion of their molecules which have the same physicochemical properties as normal molecules and can easily be bound to the enzyme Since they lack the ability to participate in biochemical reactions, this binding is accompanied by a blockade of enzymes, and consequently, a growth inhibition followed by death of the microorganism.

According to the character of action, antibiotics are subdivided into bacteriostatic (tetracyclines, chloramphenicol, and others) and bactericidal (penicillines, ristomycin, and others). Each antibiotic is characterized by a specific antimicrobial spectrum of action. Some antibiotics are inactivated in the presence of animal and plant proteins. Only a few antibiotics have a powerful antibacterial action, which does not decrease in the presence of protein matter of animal tissues and at the same time is not toxic (in certain concentrations) for the human being.

The mechanism of action of antibiotics varies. Penicillin inhibits the synthesis of polymers of the bacterial cell wall (it hinders the use of muramic acid by bacteria), which leads to an increase of cells  incapable of multiplication. Sometimes the action of penicillin leads to the formation of L-forms in the shape of pleomorphic protoplasmic structures. Thus, penicillin has a lethal effect not on the given population, but on its off-spring. The selective action of penicillin on microbes hinders the penetration of glutamic and other amino acids through the cytoplasmic membrane of pathogenic cocci unable to synthesize amino acids which are vitally important for the existence of these bacteria. Penicillin inhibits the ability of the bacterial cell to absorb protein components — aminoacids, and it inhibits the synthesis of the enzyme system and also of adaptive enzymes.

 

Описание: Scheme_4

 

 

Описание: http://intranet.tdmu.edu.ua/data/kafedra/internal/micbio/classes_stud/en/med/lik/ptn/Microbiology,%20virology%20and%20immunology/2/04_Types%20of%20bacterial%20respiration.files/image113.jpg

 

Streptomycin inhibits the incorporation of some amino acids in protein synthesis and attacks the bacterial enzyme with the participation of  which the introduction of pyruvic acid into the tricarbonic acid cycle by its union with oxalacetic acid takes place. This antibiotic inhibits the activity of biotin-containing enzymes catalysing the union of carbon dioxide with carbonic acids; it disturbs reading of the genetic code and synthesizes leucine instead of alanine.

Of special interest is the mechanism of action of streptomycin on tubercle bacilli. This preparation does not have a sterilizing action, but inhibits the respiration of tubercle bacilli, which leads to the inhibition of cell reproduction and toxin formation. At the same time stimulation of tissue respiration occurs in the patient as well as an increase in the ability of the macro-organism to destroy tubercle bacilli and their toxins.

The selective action of streptomycin on the tubercle bacillus is due to the fact that the permeability of cell membranes in the bacilli and in the tissue cells  of animals and man differs due to the dissimilar chemical structure of the cytoplasm of these organisms.

There are data showing that streptomycin inhibits the capacity of bacterial cells of the colibacillus to oxidize fumaric and glutamic acids. This leads to an inhibition of adaptive enzyme production.

Chloramphenicol is a specific inhibitor of the biosynthesis of bacterial protein. It comes into action with the peptidyl transferase area of 50S ribosome. Competing with the aminoacyl end of the aminoacyl tRNA, chloramphenicol blocks the formation of the peptide bond.

Tetracyclines, lincomycin, erythromycin, kanamycin, neomycin, spectinomycin, sparsomycin, fucidine and others belong to the group of antibiotics which inhibit protein biosynthesis in bacteria at the ribosome level. The antibiotic rifampicin suppresses protein biosynthesis by inhibiting the activity of RNA polymerase.

Antifungal antibiotics impair the intactness of the cytoplasmic membrane in fungi; antineoplastic antibiotics suppress the synthesis of nucleic acids in bacterial and animal cells and bind with DNA which serves as the matrix for RNA synthesis; bruneomycin leads to sharp inhibition of the synthesis of DNA or to its destruction.

 

There are various hypotheses and theories which have not entirely revealed the mechanism of action of antibiotics, and this question has not been completely solved.

 

The activity of antibiotics is expressed in international units (IU). Thus, for example, 1 IU of penicillin (Oxford unit) is the smallest amount of preparation inhibiting the growth of a standard Staphylococcus aureus strain. Recently the method of determining the activity of antibiotics according to the weight of the preparation has received wide application.

One unit of activity (AU) corresponds to the activity of 0.6 micrograms (ug) of. the chemically pure crystalline sodium salt of benzylpenicillin. Consequently, in 1 mg of sodium salt of benzylpenicillin there may  be 1667 AU, and in 1 mg of potassium salt — 1600 AU. For practical purposes both preparations are manufactured with an activity not less than 1550 AU.

The concentration of dry preparations as well as of solutions is expressed as the number of micrograms of active substance in 1 g of preparation or in 1 mg of solution.

 

Antibiotics are classified according to the chemical structure of the dmg, the molecular mechanism, and the spectrum of activity exerted on the cells.

 

According to origin, antibiotics are subdivided into the following groups.

Описание: Scheme_2

 

Antibiotics produced by fungi. Penicillin is produced by the fungi Penicillium notatum, Penicillium chrysogenum, etc. Penicillin is produced as sodium and potassium salts. It dissolves readily in water, but its solutions are not stable. It is a dipeptide consisting of dimethylcysteine and acetylserine.

Penicillin is used in staphylococcal, streptococcal, and meningococcal infections, anaerobic infections, gonorrhoea, syphilis, leptospirosis, anthrax and other diseases.

Penicillin preparations include ecmonovocillin which is a form of long-acting penicillin, maintaining the necessary therapeutic concentration of penicillin in the blood. It is used only for intramuscular injections. The indications are the same as for the application of penicillin.

Semisynthetic penicillins (methicillin, oxacillin) are used in infection with penicillin-resistant staphylococci; ampicillin is prescribed in mixed infections. Resistance, however, develops faster to semisynthetic preparations than to natural ones. Novobiocin and ristomycin cause a favourable therapeutic effect.

Antibiotics produced by actinomycetes. 1. Streptomycin is obtained from Streptomyces griseus. Chemically it consists of two components: the nitrous base of streptidin and streptobiosamine. Streptomycin is a base and forms salts with acids, which readily dissolve in water and are insoluble in organic solvents. It has a bacteriostatic property in relation to Gram-negative as well as to Gram-positive pathogenic microbes.

Streptomycin has a good therapeutic action on tuberculosis, tuberculous meningitis, plague, brucellosis, tularaemia, whooping cough, etc.

2. Chloramphenicol is obtained from the cultural fluid of a strain of Streptomyces venezuelae, isolated from the soil in tropical South America. It has a good therapeutic effect during dysentery, enteric fever, typhus fever and other rickettsioses.

3. Chlortetracycline (biomycin, aureomycin) is produced by Streptomyces aureofaciens. It is employed during staphylococcal infections, pneumonia, subacute septic endocarditis, rickettsioses, amoebiasis, dysentery, whooping cough, gonorrhoea, brucellosis, tularaemia, trachoma, psittacosis, peritonitis, surgical sepsis and other diseases.

4. Tetracycline is a derivative of chlortetracycline. It is obtained by reductive dechlorination of chlortetracycline. Tetracycline has a wide spectrum of action, it inhibits many species of Gram-positive, Gram-negative and acid-fast microbes. It also inhibits the development of many rickettsiae and some protozoa. It is used in treating patients with cholera, pneumonia, subacute septic endocarditis, amoebiasis, dysentery, whooping cough, gonorrhoea, in diseases of the urogenital tract, typhus fever and other rickettsioses, and for the prevention of suppurative processes in surgery. Tetracycline hydrochloride is manufactured in the form of pills with pure tetracycline or in combination with nystatin.

5. Oxytetracycline (terramycin) is obtained from Streptomyces rimosus. In spectrum and mode of action it is close to chlortetracycline. Rondomycin (6-methyl-5-hydroxytetracycline) is a homologue of oxytetracycline. It is absorbed rapidly. Rondomycin possesses a broad spectrum of action (suppresses Gram-positive and Gram-negative bacteria, i. e. cocci, Salmonella organisms, Shigella organisms, pathogenic E. coli serotypes) and is administered per os.

6. Erythromycin is obtained from Streptomyces erythraeus. It is administered in streptococcal diseases. In experiments on animals it has proved to be effective in diseases caused by Gram-positive and Gram-negative bacteria, rickettsiae, chlamydias, intestinal amoebae and trichomonads. Diphtheria bacilli are quite sensitive to erythromycin

7. Neomycin has been isolated from Streptomyces fradiae. It has a bacteriostatic action against Gram-negative and Gram-positive bacteria. The preparation is slightly toxic. It is prescribed mainly for the local treatment of suppurative processes, caused by staphylococci which are resistant to penicillin and to other antibiotics, and also during colienteritis, the causative agents of which are the pathogenic serotypes of E. coli.

8. Nystatin has been extracted from the cultural fluid of Streptomyces noursei. It inhibits many pathogenic fungi and some pathogenic protozoa. It is non-toxic when used per os. It has received wide application in treatment of candidiasis.

9. Kanamycin is an antibiotic produced by Streptomyces kanamycetius. In mode of action it resembles streptomycin and neomycin. It inhibits the growth of Gram-positive and Gram-negative bacteria. Kanamycin is used for treating patients with tuberculosis in whom the causative agent became resistant to antituberculous chemopreparations and antibiotics. It is prescribed for treating anthrax, gonorrhoea and for acute and chronic forms of infections of the urinary tract, and diseases caused by resistant strains of staphylococci.

Cycloserine obtained from Streptomyces lavendulae and other actinomycetes belongs to this group of antibiotics. It produces a beneficial therapeutic effect in tuberculosis; it disturbs the synthesis of the cell wall of mycobacteria and other Gram-positive micro-organisms. Oleandomycin obtained from Streptomyces antibioticus culture fluid inhibits the vital activity of Gram-positive bacteria, Mycobactenum tuberculosis, rickettsia, and Chlamidobacteriales organisms. Levorin produced by Actinomyces levoris is employed for treating superficial and deep candidiases.

Amphotericin (A and B) are antimycotic antibiotics obtained from Streptomyces nodosum. They are effective against yeast-like fungi, pathogens of deep and systemic mycosis, particularly, histoplasmosis, chromomycosis, sporotrichosis.

Описание: fig11_3

                Chemical structure  of differens antibiotics

 

Antibiotics produced by bacteria. 1. Gramicidin isolated from a culture of B. brevis has a bacteriostatic and bactericidal action on some pyogenic cocci.

2. Polymyxins  are produced by Bac. polymyxa. They are prescribed in diseases caused by Gram-negative bacteria.

 

Semisynthetic antibiotics. This group includes some penicillins obtained on the basis of6-aminopenicillmic acid, the nucleus of penicillin (methicillin, oxacillin, dioxacillm, ampicillin, etc.).

 

Описание: http://intranet.tdmu.edu.ua/data/kafedra/internal/micbio/classes_stud/en/med/lik/ptn/Microbiology,%20virology%20and%20immunology/2/04_Types%20of%20bacterial%20respiration.files/image118.jpg

Semisynthetic penicillins

 

Описание: http://intranet.tdmu.edu.ua/data/kafedra/internal/micbio/classes_stud/en/med/lik/ptn/Microbiology,%20virology%20and%20immunology/2/04_Types%20of%20bacterial%20respiration.files/image120.jpg

Semisynthetic penicillins

 

 

Описание: http://intranet.tdmu.edu.ua/data/kafedra/internal/micbio/classes_stud/en/med/lik/ptn/Microbiology,%20virology%20and%20immunology/2/04_Types%20of%20bacterial%20respiration.files/image122.jpg

 

Semisynthetic cephalosporins

 

 The antibiotic levomycetin (an analogue of natural chloramphemcol) is obtained  by synthesis. Combined preparations have also been produced on a mass scale, e. g. vitacycline (tetracycline with vitamins C, b(and B, and some others). New medicinal forms of tetracyclines having weaker side effects have been devised.

 

Methods of examination of antibiotic susceptibility

 

Method of serial dilutions in a liquid medium. Hottinger’s broth (or another medium suitable for the growth of the given micro-organism) is poured by 2-ml portions into test tubes mounted in a tube rack by ten in each row. Prepare antibiotic solution containing 100 U per ml and add 2 ml of this solution into the first test tube. Following thorough mixing, transfer with a new sterile measuring pipette 2 ml of the culture from this tube into the next one, and so on until the ninth tube is reached, from which 2 ml is poured off. The tenth tube containing no antibiotic serves as a control of cul­ture growth.

Wash the 24-hour agar culture of the studied microorganism with isotonic sodium chloride solution, determine the density of the sus­pension by the turbidity standard, and dilute to a concentration of 10000 microorganisms per ml. A sample of  0,2 ml of the obtained suspension is inoculated into all tubes of the row beginning from the control one. Thus, all tubes contain 1000 microorganisms per 1 ml. The results of the experiment are read following incubation of the tube at 37 °C for 18-20 hrs. The minimal concentration of the anti­biotic suppressing the growth of the given microorganism is deter­mined by the last test tube with a transparent broth in the presence of an intensive growth in the control one.

One may also prepare antibiotic solution in molteutrient agar to subsequently streak the tested culture onto the surface of this medium.

 

Another approach to antimicrobial susceptibility testing is the determination of the minimum inhibitory concentration (MIC) that will prevent microbial growth (fig. 3). The MIC is the lowest concentration of antimicrobic that prevents the growth of a microorganism in vitro.

Описание: http://intranet.tdmu.edu.ua/data/kafedra/internal/micbio/classes_stud/en/med/lik/ptn/Microbiology,%20virology%20and%20immunology/2/04_Types%20of%20bacterial%20respiration.files/image124.jpgThe minimum inhibitory concentration indicates the minimal concentration of the antibiotic that must be achieved at the site of infection to inhibit the growth of the microorganism being tested. By knowing the MIC and the theoretical levels of the antibiotic that may be achieved in body fluids, such as blood and urine, the physician can select the appropriate antibiotic, the dosage schedule, and the route of administration. Generally, a margin of safety of 10 times the MIC is desirable to ensure successful treatment of the disease.

MIC is not designed to determine whether the antibiotic is microbicidal. It is, however, also possible to determine the minimal bactericidal concentration (MBC). The MBC is also known as the minimal lethal concentration (MLC) (fig. 3). The minimal bactericidal concentration is the lowest concentration of an antibiotic that will kill a defined proportion of viable organisms in a bacterial suspension during a specified period of exposure. Generally, a 99.9% kill of bacteria at an initial concentration of 105-106 cells/mL during a 17- to 24-hour exposure period is used to define the MBC.

To determine the minimal bactericidal concentration, it is necessary to plate the tube suspensions showing no growth in tube dilution (MIC) tests onto an agar growth medium. This is done to determine whether the bacteria are indeed killed or whether they survive exposure to the antibiotic at the concentration being tested.

Determination of the MIC is adequate for establishing the appropriate concentration of an antibiotic that should be administered for controlling the infection in patients with normal immune response levels. Determination of the MBC is essential for patients with endocarditis (inflammation of the endocardium or lining to the heart) because the patient’s immune response cannot be relied on to remove the infecting microorganisms. It is particularly useful in determining the appropriate concentration of an antibiotic for use in treating patients with low erred immune defense responses, such as may occur in patients receiving chemotherapy treatment in cancer.

 

 

Figure. The minimum bactericidal concentration (MBC) of an antibiotic requires the demonstration that microorganisms have lost the ability to reproduce. In this example, although cell growth is inhibited at concentrations of 100 and 6,25 (MIC – 6,25 mg/vL), viable cells remain, which is shown by the formation of colonies (growth) on an agar plate lacking the antimicrobic No vable cells are detected (no growth on agar plates) at 25 mg/mL, which therefore is the MBC.

 

 

Disk diffusion technique. Into sterile Petri dishes placed on a horizontal sur­face, pour 15 ml of solid nutrient medium (most often 2 per cent agar on Hottinger’s broth containing 0.11-0.13 per cent of amine nitrogen). On the surface of solidified and slightly dried agar, pour 1 ml of suspension of 24-hour culture of the causative agent or, if no pure culture has been isolated, of the pathological material (pus, exudate) obtained for the study and diluted with isotonic saline. Spread uniformly over the agar surface the bacterial suspension, removing its remainder with a Pasteur pipette. Disks with antibio­tics (5-6 disks per plate) are placed onto the surface of the inoculated plate at a distance of 25 mm from its centre. The plates are incubated at 37 °C for 16-18 hrs, after which the results of the test are read by measuring the zones of growth retardation of microorganisms around the disks, including the diameter of the disk itself (fig.4). The size of the zones depends on the degree of

sensitivity of the causative agent to a given anti­biotic (tabl. 1). Yet, this method cannot be considered strictly quantitative.

 

 

Описание: ant04

 

 

 

Figure. Testing sensitivity of bacteria to antibiotics by the “disk method”

 

 

Table 1. Zone Size Interpretive

 

 

Antimicrobial agent

Disc code

R = mm or less

I = mm

MS = mm

S = mm or more

Amikacin

AN-30

15

15-16

–

16

Amoxicillin/
clavulanic acid
– staphylococci

AmC-30

19

–

–

20

Amoxicillin/
clavulanic acid
– other organisms

AmC-30

13

14-17

–

18

Ampicillin
– staphylococci

AM-10

28

–

–

29

Ampicillin
– G- enterics

AM-10

11

12-13

–

14

Azlocillin

AZ-75

14

15-17

–

13

Aztreonam

ATM-30

15

–

16-21

22

Carbenicillin
– Enterobacteriaceae

CB-100

17

18-22

–

23

Carbenicillin
– Pseudomonas

CB-100

13

14-16

–

17

Cefamandole

MA-30

14

15-17

–

18

Cefazolin

CZ-30

14

15-17

–

18

Cefonicid

CID-30

14

15-17

–

18

Cefoperazone

CFP-75

15

–

16-20

21

Cefotaxime

CTX-30

14

–

15-22

23

Cefotetan

CTT-30

12

–

13-15

16

Cefoxitin

FOX-30

13

–

15-17

18

Ceftazidime

CAZ-30

14

15-17

–

18

Ceftizoxime
– Pseudomonas

ZOX-30

10

–

11

–

Ceftizoxime
– other organisms

ZOX-30

14

–

15-19

20

Ceftriaxone

CRO-30

13

–

14-20

21

Cefuroxime

CXM-30

14

15-17

–

18

Cephalothin

CF-30

14

15-17

–

18

Chloramphenicol

C-30

12

13-17

–

18

Cinoxacin

CIN-100

14

15-18

–

19

Ciprofloxacin

CIP-5

15

16-20

–

21

Clindamycin

CC-2

14

15-20

–

21

Doxycycline

D-30

12

13-15

–

16

Erythromycin

E-15

13

14-22

–

23

Gentamicin

GM-10

12

13-14

–

15

Imipenem

IPM-10

13

14-5

–

16

Kanamycin

K-30

13

14-17

–

18

Methicillin
– staphylococci

DP-5

9

10-13

–

14

Mezlocillin

MZ-75

12

13-15

–

16

Minocycline

MI-30

14

15-18

–

19

Moxalactam

MOX-30

14

–

15-22

23

Nafcillin
– staphylococci

NF-1

10

11-12

–

13

nalidixic acid

NA-30

13

14-18

–

19

Netilmicin

NET-30

12

13-14

–

17

Nitrofurantoin

F/M-300

14

15-16

–

17

Norfloxacin

NOR-10

12

13-16

–

17

Oxacillin
– staphylococci

OX-1

10

11-12

–

13

Penicillin

P-10

28

–

–

29

Streptomycin

S-10

11

12-14

–

15

Sulfamethoxazole + trimethoprim

SXT

10

11-15

–

16

Tetracycline

Te-30

14

15-18

–

19

Ticarcillin

TIC-75

11

12-14

–

15

ticarcillin/clavulanic acid

TIM-85

11

12-14

–

15

Tobramycin

NN-10

12

13-14

–

15

Trimethoprim

TMP-5

10

11-15

–

16

Vancomycin

Va-30

9

10-11

 

12

 

 

Resistance of microbes to antibiotics. With the extensive use of antibiotics in medical practice, many species of pathogenic micro-organisms became resistant to them.

Resistance may develop to one or simultaneously to more antibiotics (multiple resistance).

The molecular mechanism of the production of resistance to antibiotics is determined by genes localized in the bacterial nucleoids or in the plasmids, the cytoplasmic transmissible genetic structures.

Resistance to antibiotics occurs as the result of disturbed translation of genetic information and altered synthesis of the polypeptide chain, diminished permeability of the cytoplasmic membrane and cell wall, and the formation, due to the effect of R-plasmids, of enzymes inactivating antibiotics (ampicillin, chloramphenicol, kanamycin, streptomycin, tetracycline, etc.).

Mutations according to the nucleoid genes, leading to antibiotic resistance, form with a frequency of 10–6 to 10–12. Owing to this, the occurrence of simultaneous mutations to two and more antibiotics is excluded; they may develop, however, as the result of independent mutation in a strain primarily resistant to one of the antibiotics.

Resistance to penicillin is linked with penicillinase (B-lactamase) synthesis controlled by one of the genes of the R-factor. Penicillinases are synthesized under the effect of not only the R-factor genes but also the nucleoid genes. Resistance to chloramphenicol is determined by the action of the enzyme — chloramphenicol acetyl-phenicolacetyl transferase coded by the gene of the R-factor. Five enzymes are responsible for the resistance to antibiotics of the aminoglycoside group. Inactivation of antibiotics in the R+ strains with multiple resistance is accomplished by three types of reactions, phosphorylation, acetylation, and adenylation. It has been established that a bacterial cell may be resistant to more than one antibiotic by one gene.(Fig. 8, 9).

 

 

Описание: http://intranet.tdmu.edu.ua/data/kafedra/internal/micbio/classes_stud/en/med/lik/ptn/Microbiology,%20virology%20and%20immunology/2/04_Types%20of%20bacterial%20respiration.files/image127.gifОписание: http://intranet.tdmu.edu.ua/data/kafedra/internal/micbio/classes_stud/en/med/lik/ptn/Microbiology,%20virology%20and%20immunology/2/04_Types%20of%20bacterial%20respiration.files/image129.jpg

 

Resistance plasmids (R-factors)

 

 

 

 

Описание: http://intranet.tdmu.edu.ua/data/kafedra/internal/micbio/classes_stud/en/med/lik/ptn/Microbiology,%20virology%20and%20immunology/2/04_Types%20of%20bacterial%20respiration.files/image131.jpg

 

R plasmid and genes of  resistance

 

 

 

Due account is given in medical practice to cross-resistance to antibacterial agents which have the same chemical structure. It has been found to exist between preparations of the tetracycline series and new semisynthetic antibiotics (morphocycline, glycocycline, dibiomycin, and ditetracycline), preparations of penicillin (benzylpenicillin, phenoxymethylpenicillin, ephycillin), compounds of the nitrofuran group, and between sulphanilamides.

 

 

 

Описание: http://intranet.tdmu.edu.ua/data/kafedra/internal/micbio/classes_stud/en/med/lik/ptn/Microbiology,%20virology%20and%20immunology/2/04_Types%20of%20bacterial%20respiration.files/image133.jpg

Origin of resistent forms

 

Описание: http://intranet.tdmu.edu.ua/data/kafedra/internal/micbio/classes_stud/en/med/lik/ptn/Microbiology,%20virology%20and%20immunology/2/04_Types%20of%20bacterial%20respiration.files/image135.jpg

 

Result of medical treatment of angina by antibiotics

 

Due to the wide distribution of staphylococci resistant to antibiotics a search for new preparations became necessary. At present a semisynthetic staphylococcal penicillin has been obtained which has a distinct bacteriostatic action on resistant strains of pathogenic staphylococci With the isolation of the penicilliucleus, 6-aminopenicillinic acid (6APA), it became possible to obtain various derivatives of penicillin.

Dimethylchlorotetracycline from the group of tetracyclines is used for the treatment of many infectious diseases and in doses half as strong as tetracycline. A good result has been obtained in treatment of inflammatory processes of the urinary tract.

With the discovery of the antibiotic griseofulvin dermatology was enriched with an effective preparation with the help of which diseases of the skin, hair and nails caused by fungi imperfecti could be treated.

Some antibiotics have a poisonous effect on rats, insects and mites. They are used for exterminating rodents and arthropods, the vectors of infectious diseases.

Antibiotics (kormogrisin, chlortetracycline, etc.) stimulate the growth of animals and fowl, and are therefore widely used in agriculture.

Of interest is the very difficult problem of chemotherapy of viral diseases. At present there are no effective drugs against viral infections. This is due to the biological peculiarities of viruses as obligatory intracellular parasites, which must be acted upon by other means than those used in microbial diseases. In recent years many new antibiotics have been obtained which have a good effect in the treatment of murine leucoses. Some of them are employed successfully in agriculture for treating fowl leucoses. Antitumour antibiotics include actinomycins C, D, K, F, etc., carcinophilin, mytomycin, actinoxanthin, chrysomalin, aurantin, sarcomycin.

 

 

Side effects of antibiotics. It has been established that large doses of penicillin and streptomycin have a neurotoxic action, tetracyclines affect the liver, chloromycetin has a toxic effect on the haematopoietic organs, and chlortetracycline and oxytetracycline upon intravenous injection may lead to collapse with a lethal outcome.

 

Описание: http://intranet.tdmu.edu.ua/data/kafedra/internal/micbio/classes_stud/en/med/lik/ptn/Microbiology,%20virology%20and%20immunology/2/04_Types%20of%20bacterial%20respiration.files/image137.jpg

 

Effect of tetracyclin on decolorization dental enamel

 

 Upon injection of penicillin and streptomycin a rash, contact dermatitis, angioneurotic oedema, anaphylactic reactions or allergic asthma may occur. Quite frequently allergic reactions arise during local application of antibiotics. Of the most practical importance is their indirect action which is mainly due to the development of resistant strains of micro-organisms, sometimes causing furuncles or severe generalized diseases which develop vigorously, in some cases with a lethal outcome. In case of the application of antibiotics with a wide spectrum of action infections may develop which are caused by resistant strains of Proteus and fungi. Staphylococcal colitis proceeds very severely, and is characterized by profuse diarrhoea, dehydration of the body, toxic phenomena, shock and collapse.

 

 

Описание: http://intranet.tdmu.edu.ua/data/kafedra/internal/micbio/classes_stud/en/med/lik/ptn/Microbiology,%20virology%20and%20immunology/2/04_Types%20of%20bacterial%20respiration.files/image139.jpg

 

Candidosis

 

Of great hazard is the formation of resistant staphylococci which cause various postoperative complications — persistent furunculosis and staphylococcal septicaemias.

A severe complication is anaphylactic shock from the use of penicillin in which a rapid drop in blood pressure, cyanosis, superficial breathing, loss of consciousness, and convulsions are observed, and in some cases death occurs. Complications caused by penicillin are characterized by allergic reactions and proceed according to the serum sickness type.

In prolonged use of penicillin or levomycetin (in syphilis and enteric fever) collapse is one of the severe side effects.

Contact dermatitis is an allergic reaction of a medicinal origin. This disease is caused by the action of streptomycin in medical personnel and patients using this preparation over long periods. Quite often allergic manifestations are recorded in the mucous membranes such as hyperaemia and oedema of the pharynx and tongue. In children antibiotics with a wide spectrum of action cause perianal skin hyperaemia, and hyperaemia of the rectal mucosa.

 

 

Описание: fig11_6

 

Описание: Рисунок10

 

Side effect after the reception of rifampin

 

In some countries the number of cases of infection with staphylococcal pneumonia in children has increased. It has been suggested that this can be explained partly by the origin of penicillin-resistant strains of staphylococci. The disease has the tendency of becoming complicated with abscesses, empyema, pneumothorax and the formation of cysts.

Antimicrobial agents cause the formation of numerous variants of microbes with weak pathogenicity (atypical strains, filterable forms, L-forms) which lead to the formation of latent forms of infections marked by recurrences and exacerbations.

Antibacterial agents may induce disorders of the genetic apparatus of the macro-organism’s cells and cause chromosomal aberrations; some of them possess a teratogenic effect leading to the development of foetal monstrosities if they are taken in the first days of pregnancy.

 

Due to the wide distribution of antibiotic-resistant pathogenic bacteria, combined treatment is recommended with the use of new antibiotics to which the causative agents of infectious diseases have yet not developed resistance. To prevent the development of resistant forms of microbes, combined preparations are prescribed: penicillin and streptomycin, erythromycin and oxytetracycline, etc.

 

Описание: http://intranet.tdmu.edu.ua/data/kafedra/internal/micbio/classes_stud/en/med/lik/ptn/Microbiology,%20virology%20and%20immunology/2/04_Types%20of%20bacterial%20respiration.files/image145.jpg

 

Combined action of antibiotics

 

Tetracycline with nystatine are applied for the prevention of candidiasis.

The use of preparations which block selectively R-plasmid replication and those which promote the elimination of antibiotic modifying enzymes is believed to be promising in the control of multiple antibiotic-resistance.

 

 Protein and DNA Sequencing

In the last 25 years, molecular biology has developed rapidly and it is now possible to sequence the proteins from different bacterial species, make large databases of the sequences, and use them as very powerful identification tools. Similar database have been developed for bacterial DNA and bacterial RNA, particularly the RNA that forms the structural components of bacterial ribosomes.

Such techniques are also being used to follow the development of strains of bacterial species that are currently evolving at a very rapid rate. Strains of Chlamydia trachomatis, for example, are known to be exchanging large numbers of genes, forming completely new strains in a very short time. This is worrying – this bacterium is responsible for taking the sight of 8 million people living in developing countries today. Identifying the new strains and studying how they have arisen so quickly is crucial to controlling infection and preventing new cases of blindness.

There are a few basic things regarding 16S ribosomal RNA gene analysis. The actual mechanics of the various parts of this test can be found elsewhere on the web or in an up-to-date textbook, and they may be summarized here in the future. With this comparative test, differences in the DNA base sequences between different organisms can be determined quantitatively, such that a phylogenetic tree can be constructed to illustrate probable evolutionary relatedness between the organisms.

The nucleotide base sequence of the gene which codes for 16S ribosomal RNA is becoming an important standard for the definition of bacterial species. Comparisons of the sequence between different species suggest the degree to which they are related to each other; a relatively greater or lesser difference between two species suggests a relatively earlier or later time in which they shared a common ancestor.

A comparison between eleven species of gram-negative bacteria is illustrated on a separate sequence comparison page, where the sequences are aligned such that similarities and differences can be readily seen when one scrolls to the right or left. Gaps and insertions of nucleic acid bases (the result of “frame-shift” mutations occuring over eons of time as the organisms diverge from common ancestors) which affect long stretches of DNA have to be taken into account for a proper alignment.

In an earlier version of the above-mentioned sequence comparison page, when only four species were compared with each other, a relatively short segment stood out as appearing to be “frame-shifted” when comparing Pseudomonas fluorescens with a group of three enterics. This situation is shown as follows with the nucleotide bases of the segment in question shown in red.

Pseudomonas fluorescens

…gctaataccgcatacgtcctacgggagaaagcagggg…

Our new organism, shown below as “AH”

…gctaataccgcataacgtcgcaagaccaaagcggggg…

Budvicia aquatica

…gctaataccgcgtaacgtcgaaagaccaaagcggggg…

Edwardsiella tarda

…gctaataccgcataacgtcgcaagaccaaagtggggg…

One can surmise that a frame-shift mutation – if the bases are not misplaced to the extent that the mutation becomes silent or lethal – could be a “cheap” way to effect a major change in the genotype and subsequent phenotype – perhaps resulting in one of those infamous “leaps” in evolution one hears conjectured about from time to time. Even though the specific sequence within a shifted segment of DNA may not be changed, the shift will result in the nucleotide bases being re-grouped into different triplet codes and read accordingly, and the resulting gene may produce a vastly different protein which can change the appearance or function of a cell to a significant extent. So, when sequences between two species are compared, the organisms may appear to be a bit more closely related if these relatively short frame-shifted segments were taken into consideration. (With long stretches of DNA, one would not expect independant genes farther along the chromosome to be affected.)

When a 1308-base stretch of that part of the chromosome which codes for 16S ribosomal RNA was lined up and analyzed (“manually” when I had a little time to kill) to find the extent to which the above four organisms differed from each other, the percent difference between any two organisms was determined, and the results are summarized as follows:

 PF 

 PF 

 

 AH 

 14.8*

 AH 

 

 BA 

14.5

3.2

 BA 

 

 ET 

14.9

4.3

5.0

 ET 

* An example: The same bases appear in the same sequence, position by position, for each of the two organisms except for 14.8% of the time.

With the percent differences used to denote probable evolutionary distances between the organisms, a phylogenetic tree was roughed out to illustrate the relationships. The distances between any two organisms, when read along the horizontal lines, corresponds closely to the percent differences. (The bar at the bottom signifies approximately 1% base difference.)

Описание: http://www.jlindquist.net/generalmicro/GBimages/tree4.jpg

Databases of various gene sequences are found on the web. Genbank’s database was used as the source of the above sequences. And rather than having to line up the sequences and determine the differences manually, a set of programs to analyze sequence data and plot trees are available.

Methods of examination of bacterial susceptibility to antibiotics.  The main principles of rational antibiotic therapy of diseases.

 

Various chemical substances comparatively harmless for the macroorganism but with a lethal action on pathogenic micro-organisms are widely used in medical practice for treating patients with infectious diseases and in some cases for prophylaxis.

This method was known long ago to ancient people, and was used for treating certain diseases. The Peruvian Indians discovered the therapeutic action of cinchona bark, and in the 18th century cinchona bark was brought to Europe. The inhabitants of Brazil successfully employed the root of the ipecacuanha for treating amoebiasis. Mercury has been extensively employed in the therapy of syphilis. In the middle of the 16th century this method became known to the people of Europe.

The basis of modem chemotherapy was founded by P. Ehrlich and D. Romanowsky, who formulated the main scientific principles and the essence of chemotherapy. They showed that in the treatment of each infection a substance should be found which, during injection into the diseased body, will bring the least harm to it and cause the most destructive action to the pathogenic (causative) agent. P. Ehrlich devised the principles of synthesis of medicinal substances by chemical variations: methylene blue, derivatives of arsenic–salvarsan (‘”606″), neosalvarsan (“914”). By the further development of chemistry new medicinal preparations could be obtained.

Extensive experimental and clinical tests of chemopreparations were carried out by E  Metchnikoff.

Chemopreparations should have a specific action, a maximal therapeutic effectiveness, and a minimal toxicity for the body.

As a characteristic of the quality of a medicinal preparation, P. Ehrlich introduced the chemotherapeutic index which is the ratio of the maximal tolerated dose to the minimal curative dose:

 

maximal tolerated dose (DT—Dosis tolerata)

                —————————————————————-         > 3

minimal curative dose (DC—Dosis curativa)

 

The chemotherapeutic index should not be less than 3 Chemotherapeutic preparations include a number of compounds used in medicine

Arsenic preparations (novarsenol, myarsenol, aminarsone, osarsol, etc.) are administered in syphilis, relapsing fever, trypanosomiasis, amoebiasis, balantidiasis, anthrax, sodoku, and other diseases.

Bismuth preparations (basic bismuth nitrate, xeroform, basic bismuth salicylate, bioquinol, bismoverol, bithiurol, pentabismol, etc.) are used against enterocolitis and syphilis

Antimony compounds (tartaric antimony potassium salt, stibenil, stibozan, surmine, solusurmine, etc.) are used for treating patients with leishmaniasis and venereal lymphogranulomatosis.

Mercury preparations (mercury salicylate, mercuric iodide, mercury cyanide, calomel, unguentum hydrargyri cinereum containing metallic mercury, etc.) are prescribed for treating patients with syphilis and are used as antiseptics in pyogenic diseases.

Acridine preparations (rivanol, tripaflavine, acriflavine, acricide, flavicide, etc.) are recommended for pyogenic diseases and inflammatory processes of the pharynx and nasopharynx

Antimalarial substances include more than 30 preparations, e g , chinine hydrochloride, quinine sulphate, mepacrine (acrichine), rodochin (plasmocide), proguanyl (bigumal), pyrimethamine (chloridine), resochine, quinocide sulphones and sulphonamides, sulphadiamine, etc.

Alkaloid preparations (emetine, etc.) are used for treating patients with amoebiasis.

Sulphonamide preparations. The introduction into practice of compounds of the sulphonamide group (streptocid, ethasole, norsulphazol, sulphazine, methylsulphazine, sulphadimezin, urosulphan, phthalazole, sulgine, sulphacyi, soluble sulphacyl, disulphormin, etc.) marked a revolution in the chemotherapy of bacterial infections.

Sulphonamide preparations are used for treating pyogenic diseases, tonsillitis, scarlet fever, erysipelas, pneumonia, dysentery, anaerobic infections, gonorrhoea, cystitis, venereal  lymphogranulomatosis, psittacosis, ornithosis, trachoma, blennorrhoea in the newborn, etc.

There are several points of view concerning the mechanism of action of sulphonamides on microbes.

 

Antibiotics (Fr. anti against, bios life) are chemical substances excreted by some micro-organisms which inhibit the growth and development of other microbes (in recent years several antibiotics have been obtained semisynthetically).

 

 

 

Описание: Scheme_3

 

 

Antibiotics are obtained by special methods employed m the medical industry For the production of antibiotics strains of fungi, actmomycetes, and bacteria are used, which are seeded in a nutrient substrate After a definite growth period the antibiotic is extracted, purified and concentrated, checked for inocuousness and potency of action In composition a number of antibiotics (penicillin, streptomycin, gramicidin, etc ) have optically distorted molecules The antibacterial properties of some antibiotics are associated with optical inversion of their molecules which have the same physicochemical properties as normal molecules and can easily be bound to the enzyme Since they lack the ability to participate in biochemical reactions, this binding is accompanied by a blockade of enzymes, and consequently, a growth inhibition followed by death of the microorganism.

According to the character of action, antibiotics are subdivided into bacteriostatic (tetracyclines, chloramphenicol, and others) and bactericidal (penicillines, ristomycin, and others). Each antibiotic is characterized by a specific antimicrobial spectrum of action. Some antibiotics are inactivated in the presence of animal and plant proteins. Only a few antibiotics have a powerful antibacterial action, which does not decrease in the presence of protein matter of animal tissues and at the same time is not toxic (in certain concentrations) for the human being.

The mechanism of action of antibiotics varies. Penicillin inhibits the synthesis of polymers of the bacterial cell wall (it hinders the use of muramic acid by bacteria), which leads to an increase of cells  incapable of multiplication. Sometimes the action of penicillin leads to the formation of L-forms in the shape of pleomorphic protoplasmic structures. Thus, penicillin has a lethal effect not on the given population, but on its off-spring. The selective action of penicillin on microbes hinders the penetration of glutamic and other amino acids through the cytoplasmic membrane of pathogenic cocci unable to synthesize amino acids which are vitally important for the existence of these bacteria. Penicillin inhibits the ability of the bacterial cell to absorb protein components — aminoacids, and it inhibits the synthesis of the enzyme system and also of adaptive enzymes.

 

Описание: Scheme_4

 

 

Описание: http://intranet.tdmu.edu.ua/data/kafedra/internal/micbio/classes_stud/en/med/lik/ptn/Microbiology,%20virology%20and%20immunology/2/04_Types%20of%20bacterial%20respiration.files/image113.jpg

 

Streptomycin inhibits the incorporation of some amino acids in protein synthesis and attacks the bacterial enzyme with the participation of  which the introduction of pyruvic acid into the tricarbonic acid cycle by its union with oxalacetic acid takes place. This antibiotic inhibits the activity of biotin-containing enzymes catalysing the union of carbon dioxide with carbonic acids; it disturbs reading of the genetic code and synthesizes leucine instead of alanine.

Of special interest is the mechanism of action of streptomycin on tubercle bacilli. This preparation does not have a sterilizing action, but inhibits the respiration of tubercle bacilli, which leads to the inhibition of cell reproduction and toxin formation. At the same time stimulation of tissue respiration occurs in the patient as well as an increase in the ability of the macro-organism to destroy tubercle bacilli and their toxins.

The selective action of streptomycin on the tubercle bacillus is due to the fact that the permeability of cell membranes in the bacilli and in the tissue cells  of animals and man differs due to the dissimilar chemical structure of the cytoplasm of these organisms.

There are data showing that streptomycin inhibits the capacity of bacterial cells of the colibacillus to oxidize fumaric and glutamic acids. This leads to an inhibition of adaptive enzyme production.

Chloramphenicol is a specific inhibitor of the biosynthesis of bacterial protein. It comes into action with the peptidyl transferase area of 50S ribosome. Competing with the aminoacyl end of the aminoacyl tRNA, chloramphenicol blocks the formation of the peptide bond.

Tetracyclines, lincomycin, erythromycin, kanamycin, neomycin, spectinomycin, sparsomycin, fucidine and others belong to the group of antibiotics which inhibit protein biosynthesis in bacteria at the ribosome level. The antibiotic rifampicin suppresses protein biosynthesis by inhibiting the activity of RNA polymerase.

Antifungal antibiotics impair the intactness of the cytoplasmic membrane in fungi; antineoplastic antibiotics suppress the synthesis of nucleic acids in bacterial and animal cells and bind with DNA which serves as the matrix for RNA synthesis; bruneomycin leads to sharp inhibition of the synthesis of DNA or to its destruction.

 

There are various hypotheses and theories which have not entirely revealed the mechanism of action of antibiotics, and this question has not been completely solved.

 

The activity of antibiotics is expressed in international units (IU). Thus, for example, 1 IU of penicillin (Oxford unit) is the smallest amount of preparation inhibiting the growth of a standard Staphylococcus aureus strain. Recently the method of determining the activity of antibiotics according to the weight of the preparation has received wide application.

One unit of activity (AU) corresponds to the activity of 0.6 micrograms (ug) of. the chemically pure crystalline sodium salt of benzylpenicillin. Consequently, in 1 mg of sodium salt of benzylpenicillin there may  be 1667 AU, and in 1 mg of potassium salt — 1600 AU. For practical purposes both preparations are manufactured with an activity not less than 1550 AU.

The concentration of dry preparations as well as of solutions is expressed as the number of micrograms of active substance in 1 g of preparation or in 1 mg of solution.

 

Antibiotics are classified according to the chemical structure of the dmg, the molecular mechanism, and the spectrum of activity exerted on the cells.

 

According to origin, antibiotics are subdivided into the following groups.

Описание: Scheme_2

 

Antibiotics produced by fungi. Penicillin is produced by the fungi Penicillium notatum, Penicillium chrysogenum, etc. Penicillin is produced as sodium and potassium salts. It dissolves readily in water, but its solutions are not stable. It is a dipeptide consisting of dimethylcysteine and acetylserine.

Penicillin is used in staphylococcal, streptococcal, and meningococcal infections, anaerobic infections, gonorrhoea, syphilis, leptospirosis, anthrax and other diseases.

Penicillin preparations include ecmonovocillin which is a form of long-acting penicillin, maintaining the necessary therapeutic concentration of penicillin in the blood. It is used only for intramuscular injections. The indications are the same as for the application of penicillin.

Semisynthetic penicillins (methicillin, oxacillin) are used in infection with penicillin-resistant staphylococci; ampicillin is prescribed in mixed infections. Resistance, however, develops faster to semisynthetic preparations than to natural ones. Novobiocin and ristomycin cause a favourable therapeutic effect.

Antibiotics produced by actinomycetes. 1. Streptomycin is obtained from Streptomyces griseus. Chemically it consists of two components: the nitrous base of streptidin and streptobiosamine. Streptomycin is a base and forms salts with acids, which readily dissolve in water and are insoluble in organic solvents. It has a bacteriostatic property in relation to Gram-negative as well as to Gram-positive pathogenic microbes.

Streptomycin has a good therapeutic action on tuberculosis, tuberculous meningitis, plague, brucellosis, tularaemia, whooping cough, etc.

2. Chloramphenicol is obtained from the cultural fluid of a strain of Streptomyces venezuelae, isolated from the soil in tropical South America. It has a good therapeutic effect during dysentery, enteric fever, typhus fever and other rickettsioses.

3. Chlortetracycline (biomycin, aureomycin) is produced by Streptomyces aureofaciens. It is employed during staphylococcal infections, pneumonia, subacute septic endocarditis, rickettsioses, amoebiasis, dysentery, whooping cough, gonorrhoea, brucellosis, tularaemia, trachoma, psittacosis, peritonitis, surgical sepsis and other diseases.

4. Tetracycline is a derivative of chlortetracycline. It is obtained by reductive dechlorination of chlortetracycline. Tetracycline has a wide spectrum of action, it inhibits many species of Gram-positive, Gram-negative and acid-fast microbes. It also inhibits the development of many rickettsiae and some protozoa. It is used in treating patients with cholera, pneumonia, subacute septic endocarditis, amoebiasis, dysentery, whooping cough, gonorrhoea, in diseases of the urogenital tract, typhus fever and other rickettsioses, and for the prevention of suppurative processes in surgery. Tetracycline hydrochloride is manufactured in the form of pills with pure tetracycline or in combination with nystatin.

5. Oxytetracycline (terramycin) is obtained from Streptomyces rimosus. In spectrum and mode of action it is close to chlortetracycline. Rondomycin (6-methyl-5-hydroxytetracycline) is a homologue of oxytetracycline. It is absorbed rapidly. Rondomycin possesses a broad spectrum of action (suppresses Gram-positive and Gram-negative bacteria, i. e. cocci, Salmonella organisms, Shigella organisms, pathogenic E. coli serotypes) and is administered per os.

6. Erythromycin is obtained from Streptomyces erythraeus. It is administered in streptococcal diseases. In experiments on animals it has proved to be effective in diseases caused by Gram-positive and Gram-negative bacteria, rickettsiae, chlamydias, intestinal amoebae and trichomonads. Diphtheria bacilli are quite sensitive to erythromycin

7. Neomycin has been isolated from Streptomyces fradiae. It has a bacteriostatic action against Gram-negative and Gram-positive bacteria. The preparation is slightly toxic. It is prescribed mainly for the local treatment of suppurative processes, caused by staphylococci which are resistant to penicillin and to other antibiotics, and also during colienteritis, the causative agents of which are the pathogenic serotypes of E. coli.

8. Nystatin has been extracted from the cultural fluid of Streptomyces noursei. It inhibits many pathogenic fungi and some pathogenic protozoa. It is non-toxic when used per os. It has received wide application in treatment of candidiasis.

9. Kanamycin is an antibiotic produced by Streptomyces kanamycetius. In mode of action it resembles streptomycin and neomycin. It inhibits the growth of Gram-positive and Gram-negative bacteria. Kanamycin is used for treating patients with tuberculosis in whom the causative agent became resistant to antituberculous chemopreparations and antibiotics. It is prescribed for treating anthrax, gonorrhoea and for acute and chronic forms of infections of the urinary tract, and diseases caused by resistant strains of staphylococci.

Cycloserine obtained from Streptomyces lavendulae and other actinomycetes belongs to this group of antibiotics. It produces a beneficial therapeutic effect in tuberculosis; it disturbs the synthesis of the cell wall of mycobacteria and other Gram-positive micro-organisms. Oleandomycin obtained from Streptomyces antibioticus culture fluid inhibits the vital activity of Gram-positive bacteria, Mycobactenum tuberculosis, rickettsia, and Chlamidobacteriales organisms. Levorin produced by Actinomyces levoris is employed for treating superficial and deep candidiases.

Amphotericin (A and B) are antimycotic antibiotics obtained from Streptomyces nodosum. They are effective against yeast-like fungi, pathogens of deep and systemic mycosis, particularly, histoplasmosis, chromomycosis, sporotrichosis.

Описание: fig11_3

                Chemical structure  of differens antibiotics

 

Antibiotics produced by bacteria. 1. Gramicidin isolated from a culture of B. brevis has a bacteriostatic and bactericidal action on some pyogenic cocci.

2. Polymyxins  are produced by Bac. polymyxa. They are prescribed in diseases caused by Gram-negative bacteria.

 

Semisynthetic antibiotics. This group includes some penicillins obtained on the basis of6-aminopenicillmic acid, the nucleus of penicillin (methicillin, oxacillin, dioxacillm, ampicillin, etc.).

 

Описание: http://intranet.tdmu.edu.ua/data/kafedra/internal/micbio/classes_stud/en/med/lik/ptn/Microbiology,%20virology%20and%20immunology/2/04_Types%20of%20bacterial%20respiration.files/image118.jpg

Semisynthetic penicillins

 

Описание: http://intranet.tdmu.edu.ua/data/kafedra/internal/micbio/classes_stud/en/med/lik/ptn/Microbiology,%20virology%20and%20immunology/2/04_Types%20of%20bacterial%20respiration.files/image120.jpg

Semisynthetic penicillins

 

 

Описание: http://intranet.tdmu.edu.ua/data/kafedra/internal/micbio/classes_stud/en/med/lik/ptn/Microbiology,%20virology%20and%20immunology/2/04_Types%20of%20bacterial%20respiration.files/image122.jpg

 

Semisynthetic cephalosporins

 

 The antibiotic levomycetin (an analogue of natural chloramphemcol) is obtained  by synthesis. Combined preparations have also been produced on a mass scale, e. g. vitacycline (tetracycline with vitamins C, b(and B, and some others). New medicinal forms of tetracyclines having weaker side effects have been devised.

 

Methods of examination of antibiotic susceptibility

 

Method of serial dilutions in a liquid medium. Hottinger’s broth (or another medium suitable for the growth of the given micro-organism) is poured by 2-ml portions into test tubes mounted in a tube rack by ten in each row. Prepare antibiotic solution containing 100 U per ml and add 2 ml of this solution into the first test tube. Following thorough mixing, transfer with a new sterile measuring pipette 2 ml of the culture from this tube into the next one, and so on until the ninth tube is reached, from which 2 ml is poured off. The tenth tube containing no antibiotic serves as a control of cul­ture growth.

Wash the 24-hour agar culture of the studied microorganism with isotonic sodium chloride solution, determine the density of the sus­pension by the turbidity standard, and dilute to a concentration of 10000 microorganisms per ml. A sample of  0,2 ml of the obtained suspension is inoculated into all tubes of the row beginning from the control one. Thus, all tubes contain 1000 microorganisms per 1 ml. The results of the experiment are read following incubation of the tube at 37 °C for 18-20 hrs. The minimal concentration of the anti­biotic suppressing the growth of the given microorganism is deter­mined by the last test tube with a transparent broth in the presence of an intensive growth in the control one.

One may also prepare antibiotic solution in molteutrient agar to subsequently streak the tested culture onto the surface of this medium.

 

Another approach to antimicrobial susceptibility testing is the determination of the minimum inhibitory concentration (MIC) that will prevent microbial growth (fig. 3). The MIC is the lowest concentration of antimicrobic that prevents the growth of a microorganism in vitro.

Описание: http://intranet.tdmu.edu.ua/data/kafedra/internal/micbio/classes_stud/en/med/lik/ptn/Microbiology,%20virology%20and%20immunology/2/04_Types%20of%20bacterial%20respiration.files/image124.jpgThe minimum inhibitory concentration indicates the minimal concentration of the antibiotic that must be achieved at the site of infection to inhibit the growth of the microorganism being tested. By knowing the MIC and the theoretical levels of the antibiotic that may be achieved in body fluids, such as blood and urine, the physician can select the appropriate antibiotic, the dosage schedule, and the route of administration. Generally, a margin of safety of 10 times the MIC is desirable to ensure successful treatment of the disease.

MIC is not designed to determine whether the antibiotic is microbicidal. It is, however, also possible to determine the minimal bactericidal concentration (MBC). The MBC is also known as the minimal lethal concentration (MLC) (fig. 3). The minimal bactericidal concentration is the lowest concentration of an antibiotic that will kill a defined proportion of viable organisms in a bacterial suspension during a specified period of exposure. Generally, a 99.9% kill of bacteria at an initial concentration of 105-106 cells/mL during a 17- to 24-hour exposure period is used to define the MBC.

To determine the minimal bactericidal concentration, it is necessary to plate the tube suspensions showing no growth in tube dilution (MIC) tests onto an agar growth medium. This is done to determine whether the bacteria are indeed killed or whether they survive exposure to the antibiotic at the concentration being tested.

Determination of the MIC is adequate for establishing the appropriate concentration of an antibiotic that should be administered for controlling the infection in patients with normal immune response levels. Determination of the MBC is essential for patients with endocarditis (inflammation of the endocardium or lining to the heart) because the patient’s immune response cannot be relied on to remove the infecting microorganisms. It is particularly useful in determining the appropriate concentration of an antibiotic for use in treating patients with low erred immune defense responses, such as may occur in patients receiving chemotherapy treatment in cancer.

 

 

Figure. The minimum bactericidal concentration (MBC) of an antibiotic requires the demonstration that microorganisms have lost the ability to reproduce. In this example, although cell growth is inhibited at concentrations of 100 and 6,25 (MIC – 6,25 mg/vL), viable cells remain, which is shown by the formation of colonies (growth) on an agar plate lacking the antimicrobic No vable cells are detected (no growth on agar plates) at 25 mg/mL, which therefore is the MBC.

 

 

Disk diffusion technique. Into sterile Petri dishes placed on a horizontal sur­face, pour 15 ml of solid nutrient medium (most often 2 per cent agar on Hottinger’s broth containing 0.11-0.13 per cent of amine nitrogen). On the surface of solidified and slightly dried agar, pour 1 ml of suspension of 24-hour culture of the causative agent or, if no pure culture has been isolated, of the pathological material (pus, exudate) obtained for the study and diluted with isotonic saline. Spread uniformly over the agar surface the bacterial suspension, removing its remainder with a Pasteur pipette. Disks with antibio­tics (5-6 disks per plate) are placed onto the surface of the inoculated plate at a distance of 25 mm from its centre. The plates are incubated at 37 °C for 16-18 hrs, after which the results of the test are read by measuring the zones of growth retardation of microorganisms around the disks, including the diameter of the disk itself (fig.4). The size of the zones depends on the degree of

sensitivity of the causative agent to a given anti­biotic (tabl. 1). Yet, this method cannot be considered strictly quantitative.

 

 

Описание: ant04

 

 

 

Figure. Testing sensitivity of bacteria to antibiotics by the “disk method”

 

 

Table 1. Zone Size Interpretive

 

 

Antimicrobial agent

Disc code

R = mm or less

I = mm

MS = mm

S = mm or more

Amikacin

AN-30

15

15-16

–

16

Amoxicillin/
clavulanic acid
– staphylococci

AmC-30

19

–

–

20

Amoxicillin/
clavulanic acid
– other organisms

AmC-30

13

14-17

–

18

Ampicillin
– staphylococci

AM-10

28

–

–

29

Ampicillin
– G- enterics

AM-10

11

12-13

–

14

Azlocillin

AZ-75

14

15-17

–

13

Aztreonam

ATM-30

15

–

16-21

22

Carbenicillin
– Enterobacteriaceae

CB-100

17

18-22

–

23

Carbenicillin
– Pseudomonas

CB-100

13

14-16

–

17

Cefamandole

MA-30

14

15-17

–

18

Cefazolin

CZ-30

14

15-17

–

18

Cefonicid

CID-30

14

15-17

–

18

Cefoperazone

CFP-75

15

–

16-20

21

Cefotaxime

CTX-30

14

–

15-22

23

Cefotetan

CTT-30

12

–

13-15

16

Cefoxitin

FOX-30

13

–

15-17

18

Ceftazidime

CAZ-30

14

15-17

–

18

Ceftizoxime
– Pseudomonas

ZOX-30

10

–

11

–

Ceftizoxime
– other organisms

ZOX-30

14

–

15-19

20

Ceftriaxone

CRO-30

13

–

14-20

21

Cefuroxime

CXM-30

14

15-17

–

18

Cephalothin

CF-30

14

15-17

–

18

Chloramphenicol

C-30

12

13-17

–

18

Cinoxacin

CIN-100

14

15-18

–

19

Ciprofloxacin

CIP-5

15

16-20

–

21

Clindamycin

CC-2

14

15-20

–

21

Doxycycline

D-30

12

13-15

–

16

Erythromycin

E-15

13

14-22

–

23

Gentamicin

GM-10

12

13-14

–

15

Imipenem

IPM-10

13

14-5

–

16

Kanamycin

K-30

13

14-17

–

18

Methicillin
– staphylococci

DP-5

9

10-13

–

14

Mezlocillin

MZ-75

12

13-15

–

16

Minocycline

MI-30

14

15-18

–

19

Moxalactam

MOX-30

14

–

15-22

23

Nafcillin
– staphylococci

NF-1

10

11-12

–

13

nalidixic acid

NA-30

13

14-18

–

19

Netilmicin

NET-30

12

13-14

–

17

Nitrofurantoin

F/M-300

14

15-16

–

17

Norfloxacin

NOR-10

12

13-16

–

17

Oxacillin
– staphylococci

OX-1

10

11-12

–

13

Penicillin

P-10

28

–

–

29

Streptomycin

S-10

11

12-14

–

15

Sulfamethoxazole + trimethoprim

SXT

10

11-15

–

16

Tetracycline

Te-30

14

15-18

–

19

Ticarcillin

TIC-75

11

12-14

–

15

ticarcillin/clavulanic acid

TIM-85

11

12-14

–

15

Tobramycin

NN-10

12

13-14

–

15

Trimethoprim

TMP-5

10

11-15

–

16

Vancomycin

Va-30

9

10-11

 

12

 

 

Resistance of microbes to antibiotics. With the extensive use of antibiotics in medical practice, many species of pathogenic micro-organisms became resistant to them.

Resistance may develop to one or simultaneously to more antibiotics (multiple resistance).

The molecular mechanism of the production of resistance to antibiotics is determined by genes localized in the bacterial nucleoids or in the plasmids, the cytoplasmic transmissible genetic structures.

Resistance to antibiotics occurs as the result of disturbed translation of genetic information and altered synthesis of the polypeptide chain, diminished permeability of the cytoplasmic membrane and cell wall, and the formation, due to the effect of R-plasmids, of enzymes inactivating antibiotics (ampicillin, chloramphenicol, kanamycin, streptomycin, tetracycline, etc.).

Mutations according to the nucleoid genes, leading to antibiotic resistance, form with a frequency of 10–6 to 10–12. Owing to this, the occurrence of simultaneous mutations to two and more antibiotics is excluded; they may develop, however, as the result of independent mutation in a strain primarily resistant to one of the antibiotics.

Resistance to penicillin is linked with penicillinase (B-lactamase) synthesis controlled by one of the genes of the R-factor. Penicillinases are synthesized under the effect of not only the R-factor genes but also the nucleoid genes. Resistance to chloramphenicol is determined by the action of the enzyme — chloramphenicol acetyl-phenicolacetyl transferase coded by the gene of the R-factor. Five enzymes are responsible for the resistance to antibiotics of the aminoglycoside group. Inactivation of antibiotics in the R+ strains with multiple resistance is accomplished by three types of reactions, phosphorylation, acetylation, and adenylation. It has been established that a bacterial cell may be resistant to more than one antibiotic by one gene.(Fig. 8, 9).

 

 

Описание: http://intranet.tdmu.edu.ua/data/kafedra/internal/micbio/classes_stud/en/med/lik/ptn/Microbiology,%20virology%20and%20immunology/2/04_Types%20of%20bacterial%20respiration.files/image127.gifОписание: http://intranet.tdmu.edu.ua/data/kafedra/internal/micbio/classes_stud/en/med/lik/ptn/Microbiology,%20virology%20and%20immunology/2/04_Types%20of%20bacterial%20respiration.files/image129.jpg

 

Resistance plasmids (R-factors)

 

 

 

 

Описание: http://intranet.tdmu.edu.ua/data/kafedra/internal/micbio/classes_stud/en/med/lik/ptn/Microbiology,%20virology%20and%20immunology/2/04_Types%20of%20bacterial%20respiration.files/image131.jpg

 

R plasmid and genes of  resistance

 

 

 

Due account is given in medical practice to cross-resistance to antibacterial agents which have the same chemical structure. It has been found to exist between preparations of the tetracycline series and new semisynthetic antibiotics (morphocycline, glycocycline, dibiomycin, and ditetracycline), preparations of penicillin (benzylpenicillin, phenoxymethylpenicillin, ephycillin), compounds of the nitrofuran group, and between sulphanilamides.

 

 

 

Описание: http://intranet.tdmu.edu.ua/data/kafedra/internal/micbio/classes_stud/en/med/lik/ptn/Microbiology,%20virology%20and%20immunology/2/04_Types%20of%20bacterial%20respiration.files/image133.jpg

Origin of resistent forms

 

Описание: http://intranet.tdmu.edu.ua/data/kafedra/internal/micbio/classes_stud/en/med/lik/ptn/Microbiology,%20virology%20and%20immunology/2/04_Types%20of%20bacterial%20respiration.files/image135.jpg

 

Result of medical treatment of angina by antibiotics

 

Due to the wide distribution of staphylococci resistant to antibiotics a search for new preparations became necessary. At present a semisynthetic staphylococcal penicillin has been obtained which has a distinct bacteriostatic action on resistant strains of pathogenic staphylococci With the isolation of the penicilliucleus, 6-aminopenicillinic acid (6APA), it became possible to obtain various derivatives of penicillin.

Dimethylchlorotetracycline from the group of tetracyclines is used for the treatment of many infectious diseases and in doses half as strong as tetracycline. A good result has been obtained in treatment of inflammatory processes of the urinary tract.

With the discovery of the antibiotic griseofulvin dermatology was enriched with an effective preparation with the help of which diseases of the skin, hair and nails caused by fungi imperfecti could be treated.

Some antibiotics have a poisonous effect on rats, insects and mites. They are used for exterminating rodents and arthropods, the vectors of infectious diseases.

Antibiotics (kormogrisin, chlortetracycline, etc.) stimulate the growth of animals and fowl, and are therefore widely used in agriculture.

Of interest is the very difficult problem of chemotherapy of viral diseases. At present there are no effective drugs against viral infections. This is due to the biological peculiarities of viruses as obligatory intracellular parasites, which must be acted upon by other means than those used in microbial diseases. In recent years many new antibiotics have been obtained which have a good effect in the treatment of murine leucoses. Some of them are employed successfully in agriculture for treating fowl leucoses. Antitumour antibiotics include actinomycins C, D, K, F, etc., carcinophilin, mytomycin, actinoxanthin, chrysomalin, aurantin, sarcomycin.

 

 

Side effects of antibiotics. It has been established that large doses of penicillin and streptomycin have a neurotoxic action, tetracyclines affect the liver, chloromycetin has a toxic effect on the haematopoietic organs, and chlortetracycline and oxytetracycline upon intravenous injection may lead to collapse with a lethal outcome.

 

Описание: http://intranet.tdmu.edu.ua/data/kafedra/internal/micbio/classes_stud/en/med/lik/ptn/Microbiology,%20virology%20and%20immunology/2/04_Types%20of%20bacterial%20respiration.files/image137.jpg

 

Effect of tetracyclin on decolorization dental enamel

 

 Upon injection of penicillin and streptomycin a rash, contact dermatitis, angioneurotic oedema, anaphylactic reactions or allergic asthma may occur. Quite frequently allergic reactions arise during local application of antibiotics. Of the most practical importance is their indirect action which is mainly due to the development of resistant strains of micro-organisms, sometimes causing furuncles or severe generalized diseases which develop vigorously, in some cases with a lethal outcome. In case of the application of antibiotics with a wide spectrum of action infections may develop which are caused by resistant strains of Proteus and fungi. Staphylococcal colitis proceeds very severely, and is characterized by profuse diarrhoea, dehydration of the body, toxic phenomena, shock and collapse.

 

 

Описание: http://intranet.tdmu.edu.ua/data/kafedra/internal/micbio/classes_stud/en/med/lik/ptn/Microbiology,%20virology%20and%20immunology/2/04_Types%20of%20bacterial%20respiration.files/image139.jpg

 

Candidosis

 

Of great hazard is the formation of resistant staphylococci which cause various postoperative complications — persistent furunculosis and staphylococcal septicaemias.

A severe complication is anaphylactic shock from the use of penicillin in which a rapid drop in blood pressure, cyanosis, superficial breathing, loss of consciousness, and convulsions are observed, and in some cases death occurs. Complications caused by penicillin are characterized by allergic reactions and proceed according to the serum sickness type.

In prolonged use of penicillin or levomycetin (in syphilis and enteric fever) collapse is one of the severe side effects.

Contact dermatitis is an allergic reaction of a medicinal origin. This disease is caused by the action of streptomycin in medical personnel and patients using this preparation over long periods. Quite often allergic manifestations are recorded in the mucous membranes such as hyperaemia and oedema of the pharynx and tongue. In children antibiotics with a wide spectrum of action cause perianal skin hyperaemia, and hyperaemia of the rectal mucosa.

 

 

Описание: fig11_6

 

Описание: Рисунок10

 

Side effect after the reception of rifampin

 

In some countries the number of cases of infection with staphylococcal pneumonia in children has increased. It has been suggested that this can be explained partly by the origin of penicillin-resistant strains of staphylococci. The disease has the tendency of becoming complicated with abscesses, empyema, pneumothorax and the formation of cysts.

Antimicrobial agents cause the formation of numerous variants of microbes with weak pathogenicity (atypical strains, filterable forms, L-forms) which lead to the formation of latent forms of infections marked by recurrences and exacerbations.

Antibacterial agents may induce disorders of the genetic apparatus of the macro-organism’s cells and cause chromosomal aberrations; some of them possess a teratogenic effect leading to the development of foetal monstrosities if they are taken in the first days of pregnancy.

 

Due to the wide distribution of antibiotic-resistant pathogenic bacteria, combined treatment is recommended with the use of new antibiotics to which the causative agents of infectious diseases have yet not developed resistance. To prevent the development of resistant forms of microbes, combined preparations are prescribed: penicillin and streptomycin, erythromycin and oxytetracycline, etc.

 

Описание: http://intranet.tdmu.edu.ua/data/kafedra/internal/micbio/classes_stud/en/med/lik/ptn/Microbiology,%20virology%20and%20immunology/2/04_Types%20of%20bacterial%20respiration.files/image145.jpg

 

Combined action of antibiotics

 

Tetracycline with nystatine are applied for the prevention of candidiasis.

The use of preparations which block selectively R-plasmid replication and those which promote the elimination of antibiotic modifying enzymes is believed to be promising in the control of multiple antibiotic-resistance.

 

 

 

 

 

References

1.                     Review of Medical Microbiology /E. Jawetz, J. Melnick, E. A. Adelberg/ Lange Medical Publication, Los Altos, California, 2002. – P.46-87.

2.                     Medical Microbiology and Immunology: Examination and Board Rewiew /W. Levinson, E. Jawetz.– 2003.– P.14-16

3.                     Handbook on Microbiology. Laboratory diagnosis of Infectious Disease/ Ed by Yu.S. Krivoshein, 1989, P. 29-74.

4.                     Essentials of Medical Microbiology / W.A. Volk at al., – Lippincott-Raven, Philadelphia-New-York

Leave a Reply

Your email address will not be published. Required fields are marked *

Приєднуйся до нас!
Підписатись на новини:
Наші соц мережі