Theme 6.

June 17, 2024
0
0
Зміст

Theme 6. MAIN METHODS,  PRINCIPLES and steps OF ISOLATING OF BACTERIA’s  PURE CULTURES.

 

 

For selection the pure culture of microorganism , it follows to separate numerous bacteria which are in tested material , one from other. It is possible to attain by means of methods which are based on two principles – mechanical and biological separation of bacteria.

 

Mechanical principle

Biological principle

METHODS

1. Factional dilutions ( L. Pasteur’s technique)

2. Pour plate technique

 (Dilution in solid nutrient media by R. Koch’s technique)

3. Spread plate technique

(Superficial dispersions by Drigalsky’s technique)

4. Streak plate technique

 

METHODS

Take into account into consideration :

– Respiration type (Fortner’s method);

– bacterial motility (Shukevich’s method

– resistance to acids (acid fast bacteria);

– sporulation;

– temperature optimum;

– selectiv   sensitiveness of laboratory animals to the bacteria and so on.

 

 

 

Methods based on mechanical mechanics,power-operated principle

Method of factional dilutions Pasteur’s technique) is based on mechanical disconnection of microorganisms by serial dilution in liquid nutrient media. The main lack of this technique: we caot make control the amount of microbal is tested tubes.

Описание: Pasteur_technique

 

Pour plate technique  (Dilution in solid nutrient media by R. Koch’s technique) is based on dilution of microbes and pouring the tested material with gelatin. After cooling the gelatin isolated colonies of microorganisms are formed and they easily can be transferred on a fresh nutrient medium by means of a platinum loop, for obtaining a microbial pure culture.

Описание: Pour_plate

 

Spread plate technique (Superficial dispersions by Drigalsky’s technique) is more perfect method which is widely spreadin everyday microbiological practice. There is quantitative technique that allows the determination of the number of bacteria in a sample.

Stages:

·                     Pipette the required amount of bacteria (from your dilution) on the surface of the Petri plate.

·                     Spread the inoculum over the surface of the agar medium using a hockey stick (spatula).

·                     Repeat this action on 3-4 Petri plates without sterilization of the hockey stick.

·                     Incubate the plate inverted at 37 oC.

There must be different number of microbial colony on the Petri plates.

Описание: spread_plate01

 

 

Описание: spred_plate11

 

 

Описание: image037

 

 

Описание: image221

 

Streak plate technique.

ADVANTAGES:

·       Spread millions of cells over the surface;

·       Individual cells deposited at a distance from all others;

·       Divide forming distinct colonies;

·       Distinct colonies do not touch any other colonies;

·       Clone of a single bacteria pure culture

 

You streak the plate on 3 different portion of the Petri plate, so you can draw the section that you will streak on the bottom of your plate.

Stages:

·        Using a sterile loop take a loopful of your bacteria from the broth

·        Streak a vertical line

·        Then streak gently across section 1

·        Zig-zag pattern until a 1/3 of the plate is covered

·        Do not dig into the agar

·        Sterilize the loop let it cool

·        Rotate the plate about 90 degrees and spread the bacteria from the first streak into a second area

·        Do only one streak (or very few) in the first area and once you are in the second area do not go back to the first

·        Do a zig-zag pattern until the 2nd area is covered

·        Sterilize again do the same for 3rd area

·        Make sure that your red hot loop is cool enough prior to touch the bacteria

·        After you waited a few seconds

·        Stab it into the agar in a position away from bacteria will cool it

·        If you stab where bacteria are production of aerosol

·        Incubate the plate inverted at 37 oC.

In a day it is necessary to examine the colonies for future investigation.

 

Описание: Streak_marker

Описание: streak_palte01Описание: streak_palate02

 

Or:

Описание: streak_plate

Methods based on biological life-form principle

Biological principle of disconnection of bacteria foresees the purposeful search of methods which take into account the numerous features of microbal species. Among the most widespread methods it is possible to select the followings:

1. Respiration pneusis type. All of microorganisms according to the type of respiration are divided into two basic groups: aerobic(Corynebacterium diphtheriae, Vibrio сholerae and others) and anaerobic (Clostridium tetani, Clostridium botulinum, Clostridium perfringens and so on). If tested material from which it follows to select anaerobic bacteria to warm up preliminary, and then then cultivate in anaerobic terms, these bacteria will grow exactly.

2. Sporulation. It is known that some microbes (bacilli and clostridia ) form endospores. There are Clostridium tetani , Clostridium botulinum, Clostridium perfringens, Bacillus subtilis, Bacillus cereus among them. Spores are resistant against different external environment factors . That’s why, if tested material would be heated previously and then inoculated in nutrient medium spore-forming bacteria would be grown.

3. Resistance of microbes against acids and alkali. Some microbes (Mycobacterium tuberculosis, Mycobacterium bovis) as a result of their chemical structure features are resistant agains acids. That’s why tested material with this bacteria previously is treated with 10 % sulfuric acid and later inoculated on proper nutrient medium. An extraneous flora perishes, and mycobacteria as a result of their resistance to acids grow.

Vibrio сholerae is a halophylic bacterium, and for its growth it is inoculated in 1 % alkaline peptone water. Already in 4-6 hrs it growth like a tender bluish  pellicle on the surface of medium.

4. Bacteria motility. Some microbes (Proteus vulgaris) have a tendency to creeping growth and is able to spread quickly on the surface of moist nutrient medium because they have flagella. So such bacteria are inoculated in the drop of condensation liquid which appears after the cooling the slant agar. In 16-18 hrs they spread on all surface of nutrient medium. If material from the upper part of agar would be taken we will have a pure culture of microbe.

5. A susceptibility of microbes different chemicals, antibiotics etc.  As a result of  features of metabolism some bacteria have a different susceptibility to some chemical factors. For example, staphylococci, aerobic bacilli can grow iutrient media which have 7,5–10 % to the sodium chloride. That is why for the selection of these bacteria this substance is added into yalk-salt agar and mannitol-salt agar for their selection. Other bacteria under the influence of such concentration of sodium chloride do not grow practically.

Some antibiotics (nistatin ) is used for inhibition for pathogenic fungi growth if it is necessary to obtain only bacteria. Adding the Penicillin iutrient medium inhibit the growth only gram-positive bacteria. Presence of Furazolidon  makes favorite condition for Corynebacteria and Micrococci.

6. Ability of microorganisms to penetrate through unharmed skin. Some pathogenic bacteria (Yersinia pestis) as a result of presence a lot of aggression enzymes are able to penetrate through because of an intact skin. For this purpose this reason body wool of laboratory-scale animal is shaven and tested material with different bacteria a rubbed in this skin area. Later some microbes may be obtain from the blood or internal organs.

7. A sensitiveness of laboratory animals is to the exciters of infectious diseases. Some laboratory animals show a high susceptibility to the different microorganisms.

For example, after any method of Streptococcus pneumoniae introduction into a mouse generalized pneumococcal infection are developed. An analogical picture is observed after injection of Mycobacterium tuberculosis into Guinean pig or Mycobacterium bovis into the rabbit.

•         8. Temperature optimum. The cardinal temperatures:

–         Minimum

–   Optimum

–   Maximum

Microorganisms can be grouped by the temperature ranges they require

•         Psychrophiles, low temperature optima (4°C) – Polaromonas vacuolata

•         Mesophils midrange (39°C) – Escherichia coli

•         Thermophiles high (60°C) –  Bacillus stearothermophilus

•         Hyperthermophiles  very high (>80°C) – Thermococcus celer

tisis

In everyday practice bacteriologists use such concepts as a species, a strain producer and pure culture of microorganisms.

Species – a collection of bacterial cells which share an overall similar pattern of traits in contrast to other bacteria whose pattern differs significantly

A strain is a subset of a bacterial species differing from other bacteria of the same species by some minor but identifiable difference. A strain is “a population of organisms that descends from a single organism or pure culture isolate. Strains within a species may differ slightly from one another in many ways.”

Culture: population of microorganisms grown under well defined conditions.

Pure culture – one that contains one type of microorganism.

 

  Isolation and Identification of Pure Culture of Aerobic Bacteria

 

Описание: image222

 

First day. Prepare smears of the tested material and study them under the microscope. Then, using a spatula or a bacteriological loop, streak the material onto a solid medium in a Petri dish. This ensures mechanical separation of microorganisms on the surface of the nutrient medium, which allows for their growth in isolated colo­nies. In individual cases the material to be studied is streaked onto the liquid enrichment medium and then transferred to Petri dishes with a solid nutrient medium. Place these dishes in a 37 0C incubator for 18-24 hrs.

Описание: посев_смеси

 

Описание: thermostate

Incubator

 

Second day. Following a 24-hour incubation, the cultural proper­ties of bacteria (nature of their growth on solid and liquid nutrient media) are studied.

Second day. Following a 24-hour incubation, the cultural proper­ties of bacteria (nature of their growth on solid and liquid nutrient media) are studied. Описание: Colonies

 

 

Описание: colo

Описание: Colony1

 

Macroscopic examination of colonies in transmitted and reflect­ed light. Turn the dish with its bottom to the eyes and examine the colonies in transmitted light. In the presence of various types of col­onies count them and describe each of them. The following proper­ties are paid attention to; (a) size of colonies (largo, 4-5 mm in dia­meter or more; medium, 2-4 mm; small, 1-2 mm; minute, less than 1 mm); (b) configuration of colonies {regularly or irregularly round­ed, rosette-shaped, rhizoid, etc.); (c) degree of transparency (non-transparent, semitransparent, transparent).

In a reflected light, examine the colonies from the top without opening the lid. The following data are registered in the protocol: (a) colour of the colonies (colourless, pigmented, the colour of the pigment); (b) nature of the surface (smooth, glassy, moist, wrinkled, lustreless, dry, etc.); (c) position of the colonies on the nutrient medium (protruding above the medium, submerged into the medium; flat, at the level of the medium; flattened, slightly above the me­dium).

Microscopic examination of colonies. Mount the dish, bottom up­ward, on the stage of the microscope, lower the condenser, and, using an 8 x objective, study the colonies, registering in the protocol their structure (homogeneous or amorphous, granular, fibriliar, etc.) and the nature of their edges (smooth, wavy, jagged, fringy, etc.).

Use some portion of the colonies to prepare Gram-stained smears for microscopic examination. In the presence of uniform bacteria, transfer the remainder of colonies to an agar slant for obtaining a sufficient amount of pure culture. Place the test tubes with the in­oculated medium into a 37 °C incubator for 18-24 hrs.

Third day. Using the culture which has grown on the agar slant prepare smears and stain them by the Gram method. Such char­acteristics as homogeneity of the growth, form, size, and staining of microorganisms permit definite judgement as to purity of the cul­ture. To identify the isolated pure culture, supplement the study of morphological, tinctorial, and cultural features with determination of their enzymatic and antigenic attributes, phago- and bacterio-cinosensitivity, toxigenicity, and other properties characterizing their species specificity.

To demonstrate carbohydrate-splitting enzymes, Hiss’ media are utilized. When bacteria ferment carbohydrates with acid formation, the colour of the medium changes due to the indicator present in it. Depending on the kind and species of bacteria studied, select media with respective mono- and disaccharides (glucose, lactose, maltose, sucrose), polysaccharides (starch, glycogen, inulin), higher alcohols (glycerol, mannitol). In the process of fermentation of the above sub­stances aldehydes, acids, and gaseous products (CO2, H2, etc.) are formed.

To demonstrate proteolytic enzymes in bacteria, transfer the lat­ter to a gelatin column. Allow the inoculated culture to stand at room temperature (20-22 °C) for several days, recording not only the development of liquefaction per se but its character as well (lami­nar, in the form of a nail or a fir-tree, etc.)

Proteolytic action of enzymes of microorganisms can also be ob­served following their streaking onto coagulated serum, with depres­sions forming around colonies (liquefaction). A casein clot is split in milk to form peptone, which is manifested by the fact that milk turns yellowish (milk peptonization).

More profound splitting of protein is evidenced by the formation of indol, ammonia, hydrogen sulphide, and other compounds. To detect the gaseous substances, inoculate microorganisms into a meat-peptone broth or in a 1 per cent peptone water. Leave the inocula­ted cultures in an incubator for 24-72 hrs.

To demonstrate indol by Morel’s method, soak narrow strips of filter paper with hot saturated solution of oxalic acid (indicator pa­per) and let them dry. Place the indicator paper between the test tube wall and stopper so that it does not touch the streaked medium. When indol is released by the 2nd-3rd day, the lower part of the pa­per strip turns pink as a result of its interaction with oxalic acid.

The telltale sign of the presence of ammonia is a change in the col­our of a pink litmus paper fastened between the tube wall and the stopper (it turns blue). Hydrogen sulphide is detected by means of a filter paper strip saturated with lead acetate solution, which is fast­ened between the tube wall and the stopper. Upon interaction be­tween hydrogen sulphide and lead acetate the paper darkens as a re­sult of lead sulphide formation.

To determine catalase, pour 1-2 ml of a 1 per cent hydrogen per­oxide solution over the surface of a 24-hour culture of an agar slant. The appearance of gas bubbles is considered as a positive reaction. Use a culture known to contain catalase as a control.

The reduction ability of microorganisms is studied using methylene blue, thinning, litmus, indigo carmine, neutral red, etc. Add one of the above dyes to nutrient broth or agar. The medium decolorizes if the microorganism has a reduction ability. The most widely em­ployed is Rothberger’s medium (meat-peptone agar containing 1 per cent of glucose and several drops of a saturated solution of neutral red). If the reaction is positive, a red colour of the agar changes into yellow, yellow-green, and fluorescent, while glucose fermentation is characterized by cracks in the medium.

Antigen properties of the isolated culture are investigated by the agglutination test (see p. 37) and other serological tests.

Species identification of aerobic bacteria is performed by compar­ing their morphological, cultural, biochemical, antigenic, and other properties.

 

Isolation and identification of a pure culture

First day

1. Microscopic examination of the tested material.

2. Streaking of the material tested onto nutrient media (solid, liquid).

Second day

1. Investigation  of the   cultural properties.

2. Sub-inoculation of colonies onto solid media to enrich for a pure culture.

Third day

1. Checking of the purity of the iso­lated culture.

2. Investigation of biochemical prop­erties: (a) sugarlytic, (b) proteolytic.

3. Determination of antigenic prop­erties.

4. Study of phagosensitivity, phagotyping, colicinogensitivity, colicinogenotyping, sensitivity to an­tibiotics, and other properties.

 

Isolation and Identification of Pure Culture of Anaerobic Bacteria

First day. Inoculate the studied material into Kitt-Tarozzi medi­um (nutrient medium): concentrated meat-peptone broth or Hottinger’s broth, glucose, 0.15 per cent agar (pHl 7.2-7.4).

To adsorb oxygen, place pieces of boiled liver or minced meat to form a 1-1.5 cm layer and pieces of cotton wool on the bottom of the test tube and pour in 6-7 mi of the medium. Prior to inoculation place the medium into boiling water for 10-20 min in order to remove air oxygen contained in it and then let it cool. Upon isolation of spore forms of anaerobes the inoculated culture is reheated at 80 ‘”C for 20-30 min to kill non-spore-forming bacteria. The cultures are immersed with petrolatum and placed into an incubator. Apart from Kitt-Tarozzi medium, liquid media containing 0.5-1 per cent glucose and pieces of animal organs, casein-acid and casein-mycotic hydrolysates can also be employed.

Casein-acid medium’, casein-acid hydrolysate, 0.5 1; 10 per cent yeast extract, 0.35 1: 20 per cent corn extract, 0.15 1; millet, 240 g; cotton wool, 25 g. The me­dium is poured into flasks with millet and cotton wool and sterilized for 30 min at 110 0C. Use casein-mycotic hydrolysate to obtain casein-mycotic me­dium.

Second day. Take note of changes in the enrichment medium, namely, the appearance of opacification or opacification in combination with gas formation. Take broth culture with a’ Pasteur pipette and transfer it through a layer of petrolatum onto the bottom of the test tube. Prepare smears on a glass slide in the usual manner, then flame fix and Gram-stain them.During microscopic examination record the presence of Gram-positive rod forms (with or without spores). Streak the culture from the enrichment medium onto solid nutrient media. Isolated colonies are prepared by two methods.

1. Prepare three plates with blood-sugar agar. To do it, melt and cool to 45 °C 100 ml of 2 per cent agnr on llottinger’s broth, then add 10-15 ml of deftbrinated sheep or rabbit blood and 10 ml of 20 per cent sterile glucose. Take a drop of the medium witli microorgan­isms into the first plate and spread it along the surface, using a glass spatula. Use the same spatula to streak tlic culture onto tlie second and then third plates and place them into an anaerobic jar or other similar devices at 37 ”C for 24-48 hrs (Zoisslcr’s method).

2, Anaerobic microorganisms are grown deep in a solid nutrient medium (Veinherg’s method of sequential dilutions). The culture from the medium is taken with a Pasteur pipette with a soldcd tip and transferred consecutively into the 1st, 2nd, and 3rd test tubes with 10 ml of isotonic sodium chloride solution. Continue to dilute^ transferring the material into the 4th, 5th. and 6th thin-walled test tubes (0.8 cm in diameter and 18 cm in height) with melted and cooled to 50 °C meat-peptone agar or Wilson-Blair medium (to 100 ml of melted meat-peptone agar with 1 per cent glucose add 10 ml of 20 per cent sodium sulphite solution and 1 ml of 8 per cent ferric chloride). Alter agar has solidified, place the inoculated culture into an incubator.

On the third day, study the isolated colonies formed in tlie plates and make smears from the most typical ones. The remainder is in­oculated into Kitt-Tarozzi medium. The colonies in the test tubes are removed by means of a sterile Pasteur pipette or the agar column may be pushed out of the tube by steam generated upon warming the bottom of the test tube. Some portion of the colony is used to prepare smears, while its remainder is inoculated into Kitt-Tarozzi medium to enrich pure culture to be later identified by its morpholo­gical, cultural, biochemical, toxicogenic, antigenic, and other properties.

The Vinyale-Veyone’s method is used for mechanical protection from oxygen. The seeding are made into tube with melting and cooling (at 42 0C) agar media.

 

Bases of bacterial Identification

 

Identification is the determination of whether an organism (or isolate in the case of microorganisms ) should be placed within a group of organisms known to fit within some classification scheme.

 

Morphological identification (according to the bacterial morphology) – Microscopic morphology

 

A number of morphological characteristics are useful in bacterial identification.  These include the presence or absence of:

·                                                 cell shape

Описание: image022Описание: image032

Cocci                       Rods

·                                                 cell size

·                                                 endospores

Описание: image030

Spores

·                                                 flagella

Описание: image037

Flagella

·                                                 glycocalyx

·                                                 etc.

The techniques used at the earliest stages are relatively simple. An unknown sample may contain different bacteria, so a culture is made to grow individual bacterial colonies. Bacteria taken from each type of colony is then used to make a thin smear on a glass slide and this is examined using a light microscope. Viewing the bacteria shows if they are cocci or bacilli or one of the rarer forms, such as the corkscrew shaped spirochaetes.

 

Gram Staining

Cocci and bacilli can be either gram positive bacteria or gram negative bacteria, depending on the structure of their cell wall. The Gram Stain is named after Hans Christian Gram, a bacteriologist from Denmark who developed the technique in the 1880s. The test is performed on a thin smear of an individual bacterial colony that has been spread onto a glass slide. Gram positive bacteria retain an initial stain, crystal violet, even when the bacterial smear is rinsed with a mixture of acetone and ethanol. The solvent removes the dark blue colour from gram negative bacteria, dissolving away some of the thin cell wall. When a second stain, a pink dye called fuchsin is then added, gram positive bacteria are unaffected by this, as they are already stained dark blue, but the gram negative bacteria turn bright pink. The colour difference can be seen easily using a light microscope.

Gram stain

·            Place a drop of sterile water on a microscope slide.

·  Make a light suspension of test culture in the water.

·  Allow to dry then fix the film by passing the slide three or four times through a Bunsen flame with the film uppermost.

·  Allow to cool.

·  Flood slide with crystal violet and allow to react for 60 seconds.

·  Wash with water.

·  Flood with Lugol’s (or Gram’s) iodine for 60 seconds.

·  Wash as before and drain off excess water.

·  Decolourise with acetone and wash off immediately.

·  Counterstain with dilute carbol fuchsin for 30 seconds.

· Wash and blot dry.

 

Описание: Gram_positiveОписание: gram_negat_fusobact

Gram-positive (left) and gram-negative (right) microbes

 

Acid Fast Bacteria

Spirochaetes such as the Mycobacteria that cause tuberculosis and leprosy do not stain well using the Gram Stain. Other stains that do not wash away with dilute acid are used instead. The bacteria are deeply stained, either bright red against a blue background or red against a green background. Because the stain cannot be removed by washing with acid, organisms stained by these methods are termed acid-fast bacteria.

 

Ziehl Neelsen Stain

·            Flood a fixed slide with strong carbol fuchsin.

·  Heat the slide until it steams and keep steaming for 5 minutes

·  Warning Do NOT BOIL.

·  Do NOT do this with acetone being used in the same sink.

·  Do NOT allow the slide to dry out.

·  Wash slide with water (preferably filtered water; tap water may contain mycobacteria leading to false positive results).

·  Treat with 3% acid alcohol for 10 minutes or until only a suggestion of pink remains on the film.

·  Wash film with water.

·  Counterstain for 15-30 seconds with methylene blue.

·  Wash and blot dry.

Acid-fast bacilli appear bright red while tissue cells and other bacteria stain blue.

 

Описание: image025

This stains acid-alcohol fast bacteria, e.g. mycobacteria.

 

 

Spore Stain (Modified Ziehl Neelsen method)

·            Stain the fixed film with strong carbol fuchsin for 3-5 minutes, heating until steam rises.

·  Wash with water.

·  Treat with 0.25% sulphuric acid for 15-60 seconds.

·  Wash with water.

·  Counterstain with 1% aqueous methylene blue for 5 minutes.

·  Wash and blot dry.

 

Описание: image060

Bacterial spores are seen as red structures: vegetative cells stain blue.

 

Описание: spore

Bacterial spores (Schaeffer-Fulton stain technique)

 

Motility

·            Place a drop of liquid culture on a microscope coverslip.

·  Invert over a plasticine ring on a microscope slide.

·  Examine under x40 objective (high power dry lens).

· Accidental spills may occur during this procedure.

 

 

Описание: image061

Wet mount technique

 

Описание: image062

 

Описание: motility

Left – negative test, right – positive

 

Capsule staining (relief staining with eosin)

·            Place a drop of broth culture on one end of a microscope slide.

·  Add one drop of eosin solution and leave for one minute.

·  Take a second slide and draw its edge back to contact the stained suspension.

·  Holding the second slide at 45 degrees, spread a thin layer of fluid along the first slide by a continuous forward movement.

Allow the film to air dry then examine under oil-immersion. 

 

Описание: capsule

Background material and cells stain red. Capsular material appears as an unstained halo around the cells

 

Aerobic or Anaerobic?

Finding out whether bacteria are aerobic or anaerobic helps separate them into different categories. It is relatively easy to discover whether a bacterial culture grows in the presence or absence of oxygen. Bacteria that only grow if oxygen is available are called aerobic bacteria. Anaerobic bacteria can grow without oxygen, and some species are killed by oxygen, only surviving in completely oxygen-free environments. These species are described as obligate anaerobes (see above)

 

Cultural (according to the bacterial growth signs in/on different nutrient media) – colony morphology

Описание: image031

Описание: Bacterial_colony_morphology

Описание: mixed_colony

Mixed colonies

 

Biochemical (according to the bacterial ability to utilize differen substrates) – Enzyme Tests

Within broad types of bacteria, individual species have different metabolic systems and are able to grow using a range of nutrients. Testing bacteria to find out whether they are positive or negative for specific enzymes helps narrow down their identity. For example, Staphylococcus aureus tests positive for the enzyme coagulase, but Staphylococcus epidermidis is negative for this enzyme.

Fermentative properties of microbes are used in the laboratory diagnosis of infectious diseases, and in studying microbes of the soil, water, and air.

Описание: image039

To identify the isolated pure culture, supplement the study of morphological, tinctorial, and cultural features with determination of their enzymatic and antigenic attributes, phago- and bacterio-cinosensitivity, toxigenicity, and other properties characterizing their species specificity.

To demonstrate carbohydrate-splitting enzymes, Hiss’ media are utilized. When bacteria ferment carbohydrates with acid formation, the colour of the medium changes due to the indicator present in it. Depending on the kind and species of bacteria studied, select media with respective mono- and disaccharides (glucose, lactose, maltose, sucrose), polysaccharides (starch, glycogen, inulin), higher alcohols (glycerol, mannitol). In the process of fermentation of the above sub­stances aldehydes, acids, and gaseous products (CO2, H2, etc.) are formed.

Описание: carb%20ferm

 

 

 

TSI (Triple Sugar Iron) and KIA (Kligler’s Iron Agar)

Triple Sugar Iron Agar (TSI) and Kligler’s Iron Agar (KIA) are used to determine if bacteria can ferment glucose and/or lactose and if they can produce hydrogen sulfide or other gases. (If an organism can ferment glucose, it is “glucose positive”. If it ferments lactose, it is “lactose positive”.) In addition, TSI detects the ability to ferment sucrose. These characteristics help distinguish various Enterobacteriacae, including Salmonella and Shigella, which are intestinal pathogens.

TSI contains three sugars: glucose, lactose and sucrose. Lactose and sucrose occur in 10 times the concentration of glucose (1.0% versus 0.1%). Ferrous sulfate, phenol red (a pH indicator that is yellow below pH 6.8 and red above it), and nutrient agar are also present. The tube is inoculated by stabbing into the agar butt (bottom of the tube) with an inoculating wire and then streaking the slant in a wavy pattern. Results are read at 18 to 24 hours of incubation.

Reading the Results

A yellow slant on TSI indicates the organism ferments sucrose and/or lactose. On KIA a yellow slant indicates the organism ferments lactose. (Because KIA does not contain sucrose, sucrose fermentation is not detected with KIA tests.) Other results are the same for TSI and KIA. A yellow butt shows that the organism fermented glucose. Black preciptate in the butt indicates hydrogen sulfide production.  Production of gases other than hydrogen sufide is indicated either by cracks or bubbles in the media or the media being pushed away from the bottom of the tube.    

Understanding the Results 

If an organism ferments glucose only, the entire tube turns yellow due to the effect of the acid produced on phenol red. Because there is a minimal amount of glucose present in the tube, the organism quickly exhausts it and begins oxidizing amino acids for energy. Ammonia is thus produced and the pH rises. Within 24 hours the phenol red indicator reverts to its original red color on the slant. Because TSI/KIA media is poured as a deep slant, the butt has limited oxygen and bacteria are unable to oxidize amino acids there. The butt thus remains yellow.

If an organism can ferment lactose and/or sucrose, the butt and slant will turn yellow (as they do from glucose fermentation). However, they remain yellow for at least 48 hours because of the high level of acid products produced from the abundant sugar(s).  

KIA resembles TSI in all respects except that KIA contains two sugars (lactose and glucose) while TSI contain three sugars (lactose, glucose and sucrose). Like TSI media, KIA contains 10 times as much lactose as glucose. Thus KIA tests for an organism’s ability to ferment glucose or lactose but not sucrose. 

If the gas being produced is hydrogen sulfide (H2S), it reacts with the ferrous sulfate and preciptates out as a black precipitate (ferric sulfide) in the butt. Organisms producing large amounts of hydrogen sulfide (e.g. Salmonella and Proteus) may produce so much black precipitate that it masks the yellow (acid) color of the butt.

 

Описание: kia_1

1. Reading results

 

Описание: KIA2

2. Interpreting results on TSI

 

Описание: kia3

3. Interpreting results on KIA

 

To demonstrate proteolytic enzymes in bacteria, transfer the lat­ter to a gelatin column. Allow the inoculated culture to stand at room temperature (20-22 °C) for several days, recording not only the development of liquefaction per se but its character as well (lami­nar, in the form of a nail or a fir-tree, etc.).

Описание: gelatin1Описание: gelatin%20negative

Serratia marcescens on the left is positive for gelatinase production, as evidenced by the liquidation of the media. 

Salmonella typhimurium on the right is negative, as evidenced by the solidity of the media.

 

Proteolytic action of enzymes of microorganisms can also be ob­served following their streaking onto coagulated serum, with depres­sions forming around colonies (liquefaction). A casein clot is split in milk to form peptone, which is manifested by the fact that milk turns yellowish (milk peptonization).

More profound splitting of protein is evidenced by the formation of indol, ammonia, hydrogen sulphide, and other compounds. To detect the gaseous substances, inoculate microorganisms into a meat-peptone broth or in a 1 per cent peptone water. Leave the inocula­ted cultures in an incubator for 24-72 hrs.

To demonstrate indol by Morel’s method, soak narrow strips of filter paper with hot saturated solution of oxalic acid (indicator pa­per) and let them dry. Place the indicator paper between the test tube wall and stopper so that it does not touch the streaked medium. When indol is released by the 2nd-3rd day, the lower part of the pa­per strip turns pink as a result of its interaction with oxalic acid.

The telltale sign of the presence of ammonia is a change in the col­our of a pink litmus paper fastened between the tube wall and the stopper (it turns blue).

Hydrogen sulphide is detected by means of a filter paper strip saturated with lead acetate solution, which is fast­ened between the tube wall and the stopper. Upon interaction be­tween hydrogen sulphide and lead acetate the paper darkens as a re­sult of lead sulphide formation.

Описание: R_24_ciрководень

 

To determine catalase, pour 1-2 ml of a 1 per cent hydrogen per­oxide solution over the surface of a 24-hour culture of an agar slant. The appearance of gas bubbles is considered as a positive reaction. Use a culture known to contain catalase as a control.

The reduction ability of microorganisms is studied using methylene blue, thionine, litmus, indigo carmine, neutral red, etc. Add one of the above dyes to nutrient broth or agar. The medium decolourizes if the microorganism has a reduction ability. The most widely em­ployed is Rothberger’s medium (meat-peptone agar containing 1 per cent of glucose and several drops of a saturated solution of neutral red). If the reaction is positive, a red colour of the agar changes into yellow, yellow-green, and fluorescent, while glucose fermentation is characterized by cracks in the medium.

 

Bile solubility test (Pure culture)

·            Emulsify a few colonies of the test culture in 1ml of saline to form a smooth suspension.

·  Add one drop of 10% sodium deoxycholate solution.

·  Incubate at 37oC.

·  Examine for clearing at 15 minutes, 30 minutes and 60 minutes.

Clearing should occur within 30 minutes

In a mixed culture place one drop of 10% sodium deoxycholate solution onto the test colony..

 

Описание: bile

This should lyse within 30 minutes. This method is not entirely reliable, and it is better to purify any suspected colony

 

Catalase Test

·            Using a glass capillary tube, pick a small amount of culture from the plate.

·  If possible do not pick from a blood containing medium as the presence of catalase in the medium itself may give a false positive result. This sometimes cannot be avoided.

·  Carefully invert the tube and insert it into the hydrogen peroxide solution.

·  Tilt the tube so the fluid flows onto the culture material.

· Look for the immediate formation of oxygen bubbles in the tube indicating the activity of catalase.

 

Описание: catalase3

Описание: Catalase_positiveОписание: catalase_negative

 

Catalase test positive (left) and negative (right)

 

Описание: catalase4

 

Catalase test

 

Coagulase Test

  A. Slide method:

This test detects the presence of “clumping factor” and is not a true coagulase test.

·  Place three separate drops of saline on a clean slide.

·  Suspend a loopful of test colony in two of these, and a loopful of control Staphylococcus aureus in the third.

·  With a sterile loop, add a drop of citrated rabbit plasma to one test and the control suspension.

·  Clumping occurring within 10 seconds indicates a positive result.

·  The saline control should remain evenly suspended.

B. Tube method:

·  Emulsify a few colonies of control Staphylococcus aureus and the test isolate into appropriately labelled tubes containing a 1/10 dilution of plasma in 0.85% saline.

·  Incubate at 37oC.

·  Examine for coagulation at 1, 3 and 6 hours.

 

 

Описание: plasmocoagulase

Conversion of the plasma into a soft or stiff gel, seen on tilting the tube to a horizontal position indicates a positive result.

 

DNase Test

·            Inoculate sections of tryptose agar medium containing DNA with material from test colonies.

·  Controls of known Staphylococcus aureus and Staphylococcus epidermidis should be inoculated as positive and negative controls.

·  Incubate the plate at 37oC for 18-24 hours.

·  Flood the plate with lM HCl that precipitates DNA and turns the medium cloudy.

 

 

Описание: DNAse

The presence of a zone of clearing round the area of growth indicates DNase production that has hydrolysed the DNA.

 

Lecithinase activity results in the production of an opaque zone of precipitation around the area of growth. This precipitation should not be present on that side of the plate previously inoculated with specific α-antitoxin.

Nagler Test

  Clostridium perfringens elaborates a variety of exotoxins, one of which is α-toxin (lecithinase or phospholipase C). The following test is used to demonstrate production of this specific toxin.

·  Divide an egg yolk plate into two equal sections.

·  Spread a loopful of Clostridium perfringens antitoxin over half the plate and allow to dry.

·  With a single streak, inoculate the plate with a loopful of the test culture, beginning on the untreated side of the plate.

·  Incubate at 37oC under anaerobic conditions.

 

 

Описание: lecitinase1

 

Описание: lecitinase

Lecithinase activity results in the production of an opaque zone of precipitation around the area of growth. This precipitation should not be present on that side of the plate previously inoculated with specific α-antitoxin

Optochin Test

·            Divide a blood agar plate into three equal sections.

·  Inoculate one with a known Streptococcus pneumoniae, another with a viridans streptococcus and the third with the test isolate.

·  Care must be taken to keep the cultures separate.

·  Place a 5 microgram Optochin disc (ethylene hydrocupreine hydrochloride) in the centre of the plate.

· Incubate at 37oC overnight and observe the zone of inhibition.

 

Описание: optochin

 

Oxidase Test

·            Dip a sterile swab in freshly prepared oxidase reagent (1% tetra methyl-para-phenylene diamine dihydrochloride) then touch the target colony. A positive reaction is indicated by the rapid appearance of a purple colour on the swab where the test bacteria adhere.

Описание: oxydase_test1

 

Alternatively

·  Place a drop of freshly prepared oxidase reagent (1% tetra methyl-para-phenylene diamine dihydrochloride) on a piece of filter paper in a Petri dish or on a glass slide.

·  Leave for 1 minute.

·  Using a wooden stick or a glass slide (not a wire loop) rub a small amount of the test colony onto the moistened paper.

·  Again, a positive test is indicated by the rapid appearance of a purple colour at this site.

 

Описание: oxidase%20test

 

 

Indole production – measure the ability to hydrolyse and deaminate tryptophan

– Klesiella-enterobacter-salmonella-serratia are mostly negative

– positive-red colour

Описание: indole1

 

Methyl red  – methyl red, a pH indicator with a range between 4.4(red) and 6.0(yellow)

– only species that produce suffiicient acids can maintian the pH at below4.4 against the buffer system of the test medium

– most species of Enterobacteriaceae produce strong acids. Enterobacter-serratia do not produce enough acids

 

Описание: metil_red2

Описание: Methyl%20red

Positive-stable red colour in the surface layer of the medium

 

Voges-proskauer reaction test

-this test is based on the conversion of acetoin to a red coloured complex through the action of KOH, atmospheric 02 and alpha napthol

–Klesiella-enterobacter-serratia is able to perform this pathway

–

 

Описание: Vp
Voges-proskauer reaction test. Red colour at the surface of the medium after 15 mins following the addition of reagents

 

 

Citrate utilisation test – some bacteria have the ability to utilize citrate as the sole carbon sourc and turn the medium allkaline due to production of ammonia

–Escherichia-Edwardisella-shigella-salmonella cannot utilise citrate as the sole source of carbon

 

 

Описание: citrate

Описание: Citrates

Positive – from colour green to blue

 

Urease test – some species posses the enzyme urease and able to hydrolyze urea with the release of ammonia and carbon dioxide

– this is used mainly to differentiate urease positive Proteus species from other member of Enterobacteriaceae

– positive-yellowish orange to pink

 

Описание: urea1

Описание: Urease_Test
Positive – yellowish orange to pink




The API-20E test kit for the identification of enteric bacteria (bioMerieux, Inc., Hazelwood, MO) provides an easy way to inoculate and read tests relevant to members of the Family Enterobacteriaceae and associated organisms. A plastic strip holding twenty mini-test tubes is inoculated with a saline suspension of a pure culture (as per manufacturer’s directions). This process also rehydrates the dessicated medium in each tube. A few tubes are completely filled (CIT, VP and GEL as seen in the photos below), and some tubes are overlaid with mineral oil such that anaerobic reactions can be carried out (ADH, LDC, ODC, H2S, URE).

After incubation in a humidity chamber for 18-24 hours at 37°C, the color reactions are read (some with the aid of added reagents), and the reactions (plus the oxidase reaction done separately) are converted to a seven-digit code. The code is fed into the manufacturer’s database via touch-tone telephone, and the computer voice gives back the identification, usually as genus and species. The reliability of this system is very high, and one finds systems like these in heavy use in many food and clinical labs.

Note: Discussion and illustration of the API-20E system here does not necessarily constitute any commercial endorsement of this product. It is shown in our laboratory courses as a prime example of a convenient multi-purpose testing method one may encounter out there in the “real world.”

In the following photos:

·  Note especially the color reactions for amino acid decarboxylations (ADH through ODC) and carbohydrate fermentations (GLU through ARA).

o          The amino acids tested are (in order) arginine, lysine and ornithine. Decarboxylation is shown by an alkaline reaction (red color of the particular pH indicator used).

o          The carbohydrates tested are glucose, mannitol, inositol, sorbitol, rhamnose, sucrose, melibiose, amygdalin and arabinose. Fermentation is shown by an acid reaction (yellow color of indicator).

 

·  Hydrogen sulfide production (H2S) and gelatin hydrolysis (GEL) result in a black color throughout the tube.

·  A positive reaction for tryptophan deaminase (TDA) gives a deep brown color with the addition of ferric chloride; positive results for this test correlate with positive phenylalanine and lysine deaminase reactions which are characteristic of Proteus, Morganella and Providencia.

In the first set of reactions:

·  Culture “5B” (isolated from an early stage of fermentation) is identified as Enterobacter agglomerans which has been a convenient dumping ground for organisms now being reassigned to better-defined genera and species including the new genus Pantoea. This particular isolate produces reddish (lactose +), “pimply” colonies on MacConkey Agar which exude an extremely viscous slime as may be seen; this appearance is certainly atypical of organisms identified as E. agglomerans or Pantoea in general.

·  Culture “8P44” is identified as Edwardsiella hoshinae. The CDC had identified this culture (in 1988) as the ultra-rare Biogroup 1 of Edwardsiella tarda which may not be in the API-20E database. This system probably would not be able to differentiate between these two organisms.

 

Описание: http://www.jlindquist.net/generalmicro/GBimages/API1.jpg

 

Описание: http://www.jlindquist.net/generalmicro/GBimages/API2.jpg

 

 

Serological identification (according to the bacterial antigens)

All immunological tests are based on specific antibody-antigen interaction. These tests are called serological since to make them one should use antibody-containing sera.

Serological tests are employed in the following cases: (a) to deter­mine an unknown antigen (bacterium, virus, toxin) with the help of a known antibody; (b) to identify an unknown antibody (in blood serum) with the help of a known antigen. Hence, one component (ingredient) in serological tests should always be a known entity.

The main serological tests include tests of agglutination, precipi­tation, lysis, neutralization, and their various modifications.

 

Agglutination Tests

Every individual species of bacterium has a unique collection of 3D shapes on its surface, called antigens. These are formed by the molecules on the outside of the cell wall. When a bacterium infects a human or an animal, the immune system reacts to these antigens, making a specific antibody to each one. Antiserum raised against a known bacterial species can therefore be used to positively identify if that species is present in an unknown culture. A small amount of different antiserum, specific for different bacteria, is used to test a sample. When the result is positive, the bacteria clump together, or agglutinate; when the result is negative, no clumping occurs.

 

Lancefield Grouping (Streptex Method)

·            Emulsify a loopful of the test culture in 0.4 ml of extraction enzyme.

·  Incubate at 37oC for 1 hour.

·  Add one drop of latex reagent to the appropriate circle of a black tile.

·  Next, add one drop of extract to each circle and mix, using a wooden stick.

·  Rock gently for one minute.

· Clumping indicates a positive reaction.

 

Presumptive agglutination test. A presumptive AT is performed on glass slides. Using a Pasteur pipette, transfer several drops of se­rum of low (1:10-1:20) dilutions and a drop of isotonic saline for control on a grease-free glass slide. Into each drop of the serum as well as in the control drop, inoculate a loopful of 24-hour living culture of the microorganism picked from the surface of a solid nut­rient medium or pipette one drop of the suspension of dead microor­ganisms (diagnosticum). The inoculated culture is thoroughly mixed until the drop of liquid is uniformly turbid.

The reaction takes place at room temperature. Inspect visually the results in 5-10 min; occasionally one may use a 5 X magnifying lens for this purpose. If the glass slides are placed into a humid closed chamber to prevent evaporation, the results of the test may be read in 30-40 min as well.

A positive test is indicated by the appearance in the drop with serum of large or small flakes, readily visible upon rocking of the cover-slip. In a negative test, the fluid remains uniformly turbid.

Описание: Agglut

 

Slide agglutination

 

In cases where the number of microorganisms is small and the re­sults of the test are difficult to interpret, dry the drop of the inocu­lated serum, fix the preparation, stain it with Pfeifier’s fuchsine, and study under the microscope. In a positive test, a microscopic field is largely free of microorganisms but they are accumulated in some places. In a negative test, microorganisms are uniformly distributed throughout the microscopic field. This test is known as microagglutination.

 

Bilological identification

Biological examination. Biological study consists of infecting animals for the purpose of isolating the culture of the causative agents and their subsequent examination for pathogenicity and virulence.

Choice of experimental animals depends on the aim of the study. Most frequently used are rabbits, guinea pigs, albino mice, and albino rats. This is explained by the fact that they are susceptible to the causative agents of various infections diseases in man, easy to handle, and propagate readily. Hamsters, polecats, cotton rats, monkeys, birds, etc. may also be occasionally infected.

Specialized, particularly virological, laboratories, make use of genetically standardized, so-called inbred animals (mice, rabbits, guinea pigs, and others).

Working with experimental animals, one should keep it in mind that they may have spontaneous bacterial and viral diseases and latent infections activated as a result of additional artificial in­oculation. This hinders the isolation of pure culture of the causative agent and determination of its aetiological role. Gnotobiotes (without microflora) and animals free of pathogenic microorganisms have no such drawback. Currently they include chickens, rats, mice, guinea pigs, pigs, etc.

Laboratory animals are distinguished by their species, age, and individual sensitivity toward microorganisms. Thus, in selecting animals for study it is necessary to take into account their species and age. For instance, sensitivity in mongrel animals may show con­siderable individual variations. The use of inbred animals with a definite constant susceptibility toward microorganisms excludes individual variations in sensitivity and allows for reproducible re­sults.

Animals are infected for .isolating pure culture of the causative agent in cases where it is impossible to obtain it by any other method (for example, in contamination of the studied objects by extra­neous microflora which inhibits growth of the causative agent and in case of insignificant amounts of microorganisms or their trans­formation into filtering forms). Thus, in studying decayed corpses of rodents for the presence of plague causative agents, one inoculates (with suspension of the organs or blood) guinea pigs which die 3-7 days later with manifestations of septicaemia. Pure culture of the causative agent is readily isolated from the blood of internal organs.

Contamination of susceptible animals for reproducing the infec­tious process is used in diseases caused by Rickettsia and viruses.

Injection to mice of material from a patient with tickborne enceph­alitis brings about paralysis and death in these animals. To de­termine pathogenicity and virulence of the causative agents of plague, tularaemia, botulism, anthrax, and some viral diseases, cultures obtained from patients arc inoculated into albino mice, guinea pigs. rats, or suckling mice.

Описание: image199

Mouse with tetanus signs

 

Описание: image201

Guinea pig with botulism signs

 

Phage Typing. Bacteriophage (or phage ) are viruses that infect bacteria. Phage can be very specific in what bacteria they infect and the pattern of infection by many phage may be employed in phage typing to distinguish bacterial species and strains. The molecules on the surface of the bacterial cell are also targets for bacteriophages (phages for short). These are viruses that infect bacteria and that associate with different bacterial species very specifically. It is therefore possible to identify bacteria by investigating which bacteriophages can bind to their surface.

Описание: image045

 

Protein analysis [gel electrophoresis, SDS-PAGE, establishment of clonality]

I. The size and other differences between proteins among different organisms may be determined very easily employing methods of protein separation using methods collectively known as gel electrophoresis.

II.                                                        SDS-PAGE:

· One popular technique goes by the name SDS-PAGE which stands for sodium dodecyl sulfate-polyacrylamide gel electrophoresis

· Note that another name for SDS is sodium lauryl sulfate, a detergent you will find in many shampoos.

Such methods are very good at detecting small differences between isolates and are especially good at establishing clonality.

 

Protein and DNA Sequencing

In the last 25 years, molecular biology has developed rapidly and it is now possible to sequence the proteins from different bacterial species, make large databases of the sequences, and use them as very powerful identification tools. Similar database have been developed for bacterial DNA and bacterial RNA, particularly the RNA that forms the structural components of bacterial ribosomes.

Such techniques are also being used to follow the development of strains of bacterial species that are currently evolving at a very rapid rate. Strains of Chlamydia trachomatis, for example, are known to be exchanging large numbers of genes, forming completely new strains in a very short time. This is worrying – this bacterium is responsible for taking the sight of 8 million people living in developing countries today. Identifying the new strains and studying how they have arisen so quickly is crucial to controlling infection and preventing new cases of blindness.

There are a few basic things regarding 16S ribosomal RNA gene analysis. The actual mechanics of the various parts of this test can be found elsewhere on the web or in an up-to-date textbook, and they may be summarized here in the future. With this comparative test, differences in the DNA base sequences between different organisms can be determined quantitatively, such that a phylogenetic tree can be constructed to illustrate probable evolutionary relatedness between the organisms.

The nucleotide base sequence of the gene which codes for 16S ribosomal RNA is becoming an important standard for the definition of bacterial species. Comparisons of the sequence between different species suggest the degree to which they are related to each other; a relatively greater or lesser difference between two species suggests a relatively earlier or later time in which they shared a common ancestor.

A comparison between eleven species of gram-negative bacteria is illustrated on a separate sequence comparison page, where the sequences are aligned such that similarities and differences can be readily seen when one scrolls to the right or left. Gaps and insertions of nucleic acid bases (the result of “frame-shift” mutations occuring over eons of time as the organisms diverge from common ancestors) which affect long stretches of DNA have to be taken into account for a proper alignment.

In an earlier version of the above-mentioned sequence comparison page, when only four species were compared with each other, a relatively short segment stood out as appearing to be “frame-shifted” when comparing Pseudomonas fluorescens with a group of three enterics. This situation is shown as follows with the nucleotide bases of the segment in question shown in red.

Pseudomonas fluorescens

…gctaataccgcatacgtcctacgggagaaagcagggg…

Our new organism, shown below as “AH”

…gctaataccgcataacgtcgcaagaccaaagcggggg…

Budvicia aquatica

…gctaataccgcgtaacgtcgaaagaccaaagcggggg…

Edwardsiella tarda

…gctaataccgcataacgtcgcaagaccaaagtggggg…

One can surmise that a frame-shift mutation – if the bases are not misplaced to the extent that the mutation becomes silent or lethal – could be a “cheap” way to effect a major change in the genotype and subsequent phenotype – perhaps resulting in one of those infamous “leaps” in evolution one hears conjectured about from time to time. Even though the specific sequence within a shifted segment of DNA may not be changed, the shift will result in the nucleotide bases being re-grouped into different triplet codes and read accordingly, and the resulting gene may produce a vastly different protein which can change the appearance or function of a cell to a significant extent. So, when sequences between two species are compared, the organisms may appear to be a bit more closely related if these relatively short frame-shifted segments were taken into consideration. (With long stretches of DNA, one would not expect independant genes farther along the chromosome to be affected.)

When a 1308-base stretch of that part of the chromosome which codes for 16S ribosomal RNA was lined up and analyzed (“manually” when I had a little time to kill) to find the extent to which the above four organisms differed from each other, the percent difference between any two organisms was determined, and the results are summarized as follows:

 PF   PF              

 AH                   14.8*    AH           

 BA                  14.5      3.2         BA        

 ET  14.9          4.3        5.0         ET 

* An example: The same bases appear in the same sequence, position by position, for each of the two organisms except for 14.8% of the time.

With the percent differences used to denote probable evolutionary distances between the organisms, a phylogenetic tree was roughed out to illustrate the relationships. The distances between any two organisms, when read along the horizontal lines, corresponds closely to the percent differences. (The bar at the bottom signifies approximately 1% base difference.)

Описание: http://www.jlindquist.net/generalmicro/GBimages/tree4.jpg

Databases of various gene sequences are found on the web. Genbank’s database was used as the source of the above sequences. And rather than having to line up the sequences and determine the differences manually, a set of programs to analyze sequence data and plot trees are available.

 

 

 

References

1.                      Review of Medical Microbiology /E. Jawetz, J. Melnick, E. A. Adelberg/ Lange Medical Publication, Los Altos, California, 2002. – P.46-87.

2.                      Medical Microbiology and Immunology: Examination and Board Rewiew /W. Levinson, E. Jawetz.– 2003.– P.14-16

3.                      Handbook on Microbiology. Laboratory diagnosis of Infectious Disease/ Ed by Yu.S. Krivoshein, 1989, P. 29-74.

4.                      Essentials of Medical Microbiology / W.A. Volk at al., – Lippincott-Raven, Philadelphia-New-York

 

 

 

Leave a Reply

Your email address will not be published. Required fields are marked *

Приєднуйся до нас!
Підписатись на новини:
Наші соц мережі